Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM128B-family with sequence similarity 128, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM128B-family with sequence similarity 128, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066296 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM128B |
| Origin species: | Human |
| Product name: | FAM128B-family with sequence similarity 128, member B Gene |
| Size: | 2ug |
| Accessions: | BC066296 |
| Gene id: | 80097 |
| Gene description: | family with sequence similarity 128, member B |
| Synonyms: | FAM128B; MOZART2B; mitotic-spindle organizing protein 2B; family with sequence similarity 128, member B; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B; mitotic spindle organizing protein 2B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgcagggcgtagggcctgggccggggtcggcggcgcccccggggctggaggcggcccggcagaagctggcgctgcggcggaagaaggtgctgagcaccgaggagatggagctgtacgagctggcgcaggcggcgggcggcgctatcgaccccgacgtgttcaagatcctggtggacctgctgaagctgaacgtggcccccctcgccgtcttccagatgctcaagtccatgtgtgccgggcagaggctagcgagcgagccccaggaccctgcggccgtgtctctgcccacgtcgagcgtgcccgagacccgagggagaaacaaaggcagcgctgccctcgggggagcattggccctggcggaacgcagcagccgcgaaggatccagccagaggatgccacgccagcccagcgctaccaggctgcccaaggggggcgggcctgggaagagccctacacggggcagcacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 134, member B - family with sequence similarity 168, member B - transmembrane BAX inhibitor motif containing 4 - similar to Rho GTPase activating protein 15 |