DAAM2-dishevelled associated activator of morphogenesis 2 Gene View larger

DAAM2-dishevelled associated activator of morphogenesis 2 Gene

PTXBC078153

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DAAM2-dishevelled associated activator of morphogenesis 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DAAM2-dishevelled associated activator of morphogenesis 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC078153
Product type: DNA & cDNA
Ncbi symbol: DAAM2
Origin species: Human
Product name: DAAM2-dishevelled associated activator of morphogenesis 2 Gene
Size: 2ug
Accessions: BC078153
Gene id: 23500
Gene description: dishevelled associated activator of morphogenesis 2
Synonyms: dJ90A20A.1; disheveled-associated activator of morphogenesis 2; dishevelled associated activator of morphogenesis 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccccgcaagaggagccaccatggcctgggcttcctgtgctgcttcgggggcagtgacatccccgaaatcaacctccgggacaaccaccctctgcagttcatggagttctccagccccatctcgaacgcagaggagctcaacatccgctttgcagagctggtggatgaattggatctcactgacaaaaaccgagaggctatgtttgcactgccccctgagaagaaatggcagatctactgcagcaagaagaaggtgccctctctgacccctctggccacatctcagggttcatggcatggggtggctcttgctgccttggcctgctcatgcattcacctgatgtttattacatgccagccctgttctaggtgttggaggaacaacagtgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin related protein 2/3 complex, subunit 3, 21kDa
- vacuolar protein sorting 39 homolog (S. cerevisiae)
- vacuolar protein sorting 16 homolog (S. cerevisiae)
- proteasome (prosome, macropain) activator subunit 4

Reviews

Buy DAAM2-dishevelled associated activator of morphogenesis 2 Gene now

Add to cart