Cart 12 Product Products 1 503,95 € (empty)
-
1 x ZNF576-zin...113,40 € -
1 x MC1R-melan...121,50 € -
1 x D2HGDH-D-2...113,40 € -
1 x LOC124220-...113,40 € -
1 x NINJ1-ninj...113,40 € -
1 x MSRA-methi...113,40 € -
1 x LENEP-lens...113,40 € -
1 x SLN-sarcol...113,40 € -
1 x Repac...259,07 € -
-
1 x LOC402176-...113,40 € -
1 x IL17A-inte...113,40 €
No products
To be determined Shipping
1 503,95 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 503,95 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 503,95 €
Data sheet of FAAH2-fatty acid amide hydrolase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAAH2-fatty acid amide hydrolase 2 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC073922 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAAH2 |
| Origin species: | Human |
| Product name: | FAAH2-fatty acid amide hydrolase 2 Gene |
| Size: | 2ug |
| Accessions: | BC073922 |
| Gene id: | 158584 |
| Gene description: | fatty acid amide hydrolase 2 |
| Synonyms: | AMDD; fatty-acid amide hydrolase 2; amidase domain containing; amidase domain-containing protein; anandamide amidohydrolase 2; oleamide hydrolase 2; fatty acid amide hydrolase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaccttcatttaccgcccgcattcagttgttcctcttgcgggcgctaggctttctcataggcttagtaggccgagcagctttagtcttagggggtccaaagtttgcctcaaagacccctcggccggtgactgaaccattgcttctgctttcggggatgcagctggccaagctgatccgacagagaaaggtgaaatgtatagatgttgttcaggcttatatcaacagaatcaaggacgtgaacccaatgatcaatggaattgtcaagtacaggtttgaggaagcgatgaaggaggctcatgctgtagatcaaaagcttgcagagaagcaggaagatgaagccaccctggaaaataaatggcccttccttggggttcctttgacagtcaaggaagctttccagctacaaggaatgcccaattcttctggactcatgaaccgtcgtgatgccattgccaaaacagatgccactgtggtggcattactgaagggagctggtgccattcctcttggcataaccaactgtagtgagttgtgtatgtggtatgaatccagtaacaagatctatggccgatcaaacaacccatatgatttacagcatattgtaggtggaagttctggtggtgagggctgcacactggcagctgcctgctcagttattggtgtgggctctgatattggtggtagcattcgaatgcctgctttcttcaatggtatatttggacacaagccttctccaggtgtggttcccaacaaaggtcagtttcccttggctgtgggagcccaggagttgtttctgtgcactggtcctatgtgccgctatgctgaagacctggcccccatgttgaaggtcatggcaggacctgggatcaaaaggttaaaactagacacaaaggtacatttaaaagacttaaaattttactggatggaacatgatggaggctcatttttaatgtccaaagtggaccaagatctcattatgactcagaaaaaggttgtggttcaccttgaaactattctaggagcctcagttcaacatgttaaactgaagaaaatgaagtactcttttcagttgtggatcgcaatgatgtcagcaaagggacatgatgggaaggaacctgtgaaatttgtagatttgcttggtgaccatgggaaacatgtcagtcctctgtgggagttgatcaaatggtgcctgggtctgtcagtgtacaccatcccttccattggactggctttgttggaagaaaagctcagatatagcaatgagaaataccaaaagtttaaggcagtggaagaaagcctgcgtaaagagctggtggatatgctaggtgatgatggtgtgttcttatatccctcacatcccacagtggcacctaagcatcatgtccctctaacacggcccttcaactttgcttacacaggtgtcttcagtgccctgggtttgcctgtgacccaatgcccactgggactgaatgccaaaggactccctttaggcatccaggttgtggctggaccctttaatgatcatctgaccctggctgtggcccagtacttggagaaaacttttgggggctgggtctgtccaggaaagttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein 45 - period homolog 1 (Drosophila) - receptor accessory protein 3 - RNA binding motif protein 16 |