Cart 13 Product Products 1 679,45 € (empty)
-
1 x KCTD5-pota...113,40 € -
1 x ACAA1-acet...121,50 € -
1 x FAM70A-fam...121,50 € -
1 x SPRYD4-SPR...113,40 € -
-
1 x CBR1-carbo...121,50 € -
1 x POLR1D-pol...113,40 € -
1 x C9orf27-ch...113,40 € -
1 x C20orf24-c...113,40 € -
1 x POP7-proce...113,40 € -
1 x GYPB-glyco...113,40 € -
1 x GJA5-gap...121,50 € -
1 x CACNG7-cal...121,50 €
No products
To be determined Shipping
1 679,45 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 679,45 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 679,45 €
View larger 
KCNG3-potassium voltage-gated channel, subfamily G, member 3 Gene
PTXBC071558
New product
Data sheet of KCNG3-potassium voltage-gated channel, subfamily G, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNG3-potassium voltage-gated channel, subfamily G, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071558 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNG3 |
| Origin species: | Human |
| Product name: | KCNG3-potassium voltage-gated channel, subfamily G, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC071558 |
| Gene id: | 170850 |
| Gene description: | potassium voltage-gated channel, subfamily G, member 3 |
| Synonyms: | KV10.1; KV6.3; potassium voltage-gated channel subfamily G member 3; potassium channel, voltage gated modifier subfamily G, member 3; potassium voltage-gated channel, subfamily G, member 3; voltage-gated potassium channel 6.3; voltage-gated potassium channel Kv10.1; voltage-gated potassium channel subunit Kv10.1; voltage-gated potassium channel subunit Kv6.3; voltage-gated potassium channel subunit Kv6.4; potassium voltage-gated channel modifier subfamily G member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccttcgggcgcagcggggcggcctcggtggtgctgaacgtgggcggcgcccggtattcgctgtcccgggagctgctgaaggacttcccgctgcgccgcgtgagccggctgcacggctgccgctccgagcgcgacgtgctcgaggtgtgcgacgactacgaccgcgagcgcaacgagtacttcttcgaccggcactcggaggccttcggcttcatcctgctctacgtgcgcggccacggcaagctgcgcttcgcgccgcggatgtgcgagctctccttctacaacgagatgatctactggggcctggagggcgcgcacctcgagtactgctgccagcgccgcctcgacgaccgcatgtccgacacctacaccttctactcggccgacgagccgggcgtgctgggccgcgacgaggcgcgccccggcggggccgaggcggctccctccaggcgctggctggagcgcatgcggcggaccttcgaggagcccacgtcgtcgctggccgcgcagatcctggctagcgtgtcggtggtgttcgtgatcgtgtccatggtggtgctgtgcgccagcacgttgcccgactggcgcaacgcagccgccgacaaccgcagcctggatgaccggagcaggtactccgccggccctgggagggagccctccgggataattgaagctatctgcataggttggttcactgccgagtgcatcgtgaggttcattgtctccaaaaacaagtgtgagtttgtcaagagacccctgaacatcattgatttactggcaatcacgccgtattacatctctgtgttgatgacagtgtttacaggcgagaactctcaactccagagggctggagtcaccttgagggtacttagaatgatgaggattttttgggtgattaagcttgcccgtcacttcattggtcttcagacactcggtttgactctcaaacgttgctaccgagagatggttatgttacttgtcttcatttgtgttgccatggcaatctttagtgcactttctcagcttcttgaacatgggctggacctggaaacatccaacaaggactttaccagcattcctgctgcctgctggtgggtgattatctctatgactacagttggctatggagatatgtatcctatcacagtgcctggaagaattcttggaggagtttgtgttgtcagtggaattgttctattggcattacctatcacttttatctaccatagctttgtgcagtgttatcatgagctcaagtttagatctgctaggtatagtaggagcctctccactgaattcctgaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, ATPase, 1 - glutathione peroxidase 4 (phospholipid hydroperoxidase) - cytochrome P450, family 3, subfamily A, polypeptide 7 - nucleolar complex associated 4 homolog (S. cerevisiae) |