> >>OAZ3-ornithine decarboxylase antizyme 3 Gene
OAZ3-ornithine decarboxylase antizyme 3 Gene View larger

OAZ3-ornithine decarboxylase antizyme 3 Gene

PTXBC073949

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of OAZ3-ornithine decarboxylase antizyme 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OAZ3-ornithine decarboxylase antizyme 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC073949
Product type: DNA & cDNA
Ncbi symbol: OAZ3
Origin species: Human
Product name: OAZ3-ornithine decarboxylase antizyme 3 Gene
Size: 2ug
Accessions: BC073949
Gene id: 51686
Gene description: ornithine decarboxylase antizyme 3
Synonyms: AZ3; OAZ-t; TISP15; ornithine decarboxylase antizyme 3; ODC-Az 3; antizyme 3; testicular secretory protein Li 31
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgtgccctggcggccaggaaagcgacgcatcacttataaggaagaggaggacttgacactccagccccgtcctgcctccagtgctcctgagtccctagtaggcctccaggagggcaaaagcaccgagcagggtaaccacgaccagcttaaagaactgtattcggctgggaacttgacggtgctggctactgaccccctgctccaccaggacccagtacagttagactttcacttccgccttacctcccagacctctgcccattggcacggccttctctgtgaccgtcgactcttcctggatatcccatatcaggccttggatcaaggcaaccgggaaagtttgactgcaaccctggagtacgtggaagagaagacaaatgtggactctgtgtttgtgaacttccagaatgatcggaacgacagaggtgccctgctgcgggccttcagctacatgggctttgaggtggtcagaccagatcaccctgccctccctcccttggacaatgtcatctttatggtgtatccccttgaaagggatgttggccacctgcccagtgagcctccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - voltage-dependent anion channel 2
- interleukin 23, alpha subunit p19
- Rho GTPase activating protein 5
- interleukin 23, alpha subunit p19

Reviews

Buy OAZ3-ornithine decarboxylase antizyme 3 Gene now

Add to cart