No products
Prices are tax excluded
PTXBC063856
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC063856 |
Product type: | DNA & cDNA |
Ncbi symbol: | SPRY1 |
Origin species: | Human |
Product name: | SPRY1-sprouty homolog 1, antagonist of FGF signaling (Drosophila) Gene |
Size: | 2ug |
Accessions: | BC063856 |
Gene id: | 10252 |
Gene description: | sprouty homolog 1, antagonist of FGF signaling (Drosophila) |
Synonyms: | hSPRY1; protein sprouty homolog 1; sprouty homolog 1, antagonist of FGF signaling; sprouty, Drosophila, homolog of, 1 (antagonist of FGF signaling); spry-1; sprouty RTK signaling antagonist 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggatccccaaaatcaacatggcagtggcagttcgttagttgtgatccagcagccttctttggatagccgtcagagattagactatgagagagagattcagcctactgctattttgtccttagaccagatcaaggccataagaggcagcaatgaatacacagaagggccttcggtggtgaaaagacctgctcctcggacagcaccaagacaagaaaagcatgaaaggactcatgaaatcataccaattaatgtgaataataactacgagcacagacacacaagccacctgggacatgcagtactcccaagtaatgccaggggccccattttgagcagatcaaccagcactggaagtgcagccagctctgggagcaacagcagtgcctcttctgaacagggactgttaggaaggtcaccaccaaccagaccagtccctggtcataggtctgaaagggcaatccggacccagcccaagcaactgattgtggatgacttgaagggttccttgaaagaggacctgacacagcacaagttcatttgtgaacagtgtgggaagtgcaagtgtggagaatgcactgctcccaggaccctaccatcctgtttggcctgtaaccggcagtgcctttgctctgctgagagcatggtggaatatggaacctgcatgtgcttagtcaagggcatcttctaccactgctccaatgacgacgaaggggattcctattcagataatccttgctcctgttcacaatcacactgctgctctagatacctgtgtatgggagccatgtctttatttttaccttgcttactctgttatcctcctgctaaaggatgcctgaagctgtgcaggaggtgttatgactggatccatcgcccagggtgcagatgtaagaactccaacactgtctattgtaagctggagagctgcccctcccggggtcagggtaaaccatcatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - protein kinase, cAMP-dependent, regulatory, type II, beta - LanC lantibiotic synthetase component C-like 2 (bacterial) - eukaryotic translation initiation factor 2 alpha kinase 4 - protein kinase C and casein kinase substrate in neurons 3 |