PAX3-paired box 3 Gene View larger

PAX3-paired box 3 Gene

PTXBC063547

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAX3-paired box 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAX3-paired box 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063547
Product type: DNA & cDNA
Ncbi symbol: PAX3
Origin species: Human
Product name: PAX3-paired box 3 Gene
Size: 2ug
Accessions: BC063547
Gene id: 5077
Gene description: paired box 3
Synonyms: CDHS; HUP2; WS1; WS3; paired box protein Pax-3; paired box homeotic gene 3; paired domain gene 3; paired domain gene HuP2; paired box 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagatcgtggagatggcccaccacggcatccggccctgcgtcatctcgcgccagctgcgcgtgtcccacggctgcgtctccaagatcctgtgcaggtaccaggagactggctccatacgtcctggtgccatcggcggcagcaagcccaagcaggtgacaacgcctgacgtggagaagaaaattgaggaatacaaaagagagaacccgggcatgttcagctgggaaatccgagacaaattactcaaggacgcggtctgtgatcgaaacaccgtgccgtcagtgagttccatcagccgcatcctgagaagtaaattcgggaaaggtgaagaggaggaggccgacttggagaggaaggaggcagaggaaagcgagaagaaggccaaacacagcatcgacggcatcctgagcgagcgaggaaaggccctggtctccggagtttcctcgcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0892
- syntaxin 16
- KIAA0562
- KIAA1009

Reviews

Buy PAX3-paired box 3 Gene now

Add to cart