Cart 33 Product Products 4 868,33 € (empty)
-
1 x RELT-RELT...121,50 € -
1 x LOC440461-...113,40 € -
-
1 x Phospho-My...259,07 € -
1 x SENP3...259,07 € -
1 x TALDO1-tra...121,50 € -
-
1 x PGK1-phosp...121,50 € -
1 x RRM2B-ribo...121,50 € -
1 x PHCA-phyto...121,50 € -
1 x RYBP-RING1...113,40 € -
1 x MxB...259,07 € -
1 x GPR15-G...121,50 € -
1 x NUTF2-nucl...113,40 € -
1 x CASP14-cas...113,40 € -
1 x SLC25A39-s...121,50 € -
-
1 x MAPK10-mit...121,50 € -
-
1 x SKP1-S-pha...113,40 € -
1 x Ribosomal...259,07 € -
1 x UBE2Z-ubiq...113,40 € -
1 x TMEM116-tr...113,40 € -
1 x TMEM55B-tr...121,50 € -
1 x FCRL1-Fc...121,50 € -
1 x UTP15-UTP1...121,50 € -
-
1 x KANK2...259,07 € -
1 x RSRC1-argi...121,50 € -
1 x LOC441476-...121,50 € -
1 x ZNF444-zin...121,50 € -
1 x MRGPRX4-MA...121,50 € -
1 x SLC30A4-so...121,50 €
No products
To be determined Shipping
4 868,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 868,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 868,33 €
Data sheet of FLJ32065-hypothetical protein FLJ32065 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ32065-hypothetical protein FLJ32065 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC073870 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ32065 |
| Origin species: | Human |
| Product name: | FLJ32065-hypothetical protein FLJ32065 Gene |
| Size: | 2ug |
| Accessions: | BC073870 |
| Gene id: | 201283 |
| Gene description: | hypothetical protein FLJ32065 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaaatagtacggtattccgaacagacactaaaaatagctgtcatctcaaagaatccagtgcttgtgtcacagtatgagaaagtagatgctggggaacagcgtttaatgaatgaagcattccagccagccagtgatctctttggaccttgcattctccatcagattggatcacctcccaccctgaggccccccaagactttgaacagttcttcagtcatccttacagaaagataccctctccagacaaacgcagtatttatatacggtccattggatctctatgaagcaccagaattatcagtgaagaatatattaaatggctcacgggctactgtaaagcatatttctatcgcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Shwachman-Bodian-Diamond syndrome - myotubularin related protein 11 - T cell receptor gamma variable 3 - SEC31 homolog A (S. cerevisiae) |