Cart 4 Product Products 437,06 € (empty)
-
1 x DRD5-dopam...121,50 € -
-
1 x FAM70B-fam...121,50 € -
1 x FAM71E2-fa...113,40 €
No products
To be determined Shipping
437,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 437,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 437,06 €
View larger 
NAPEPLD-N-acyl phosphatidylethanolamine phospholipase D Gene
PTXBC071604
New product
Data sheet of NAPEPLD-N-acyl phosphatidylethanolamine phospholipase D Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAPEPLD-N-acyl phosphatidylethanolamine phospholipase D Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071604 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAPEPLD |
| Origin species: | Human |
| Product name: | NAPEPLD-N-acyl phosphatidylethanolamine phospholipase D Gene |
| Size: | 2ug |
| Accessions: | BC071604 |
| Gene id: | 222236 |
| Gene description: | N-acyl phosphatidylethanolamine phospholipase D |
| Synonyms: | FMP30; NAPE-PLD; N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D; NAPE-hydrolyzing phospholipase D; N-acyl phosphatidylethanolamine phospholipase D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgaaaatgaaagcaaccagtctctgatgacaagcagccaatatcctaaagaagcagtaagaaaacgtcaaaattcagcacggaattccggagcaagtgattcttctaggttttctaggaaaagcttcaaactggattatagactagaagaagatgtaactaaatccaagaaaggaaaagatgggagatttgtgaatccgtggccaacatggaaaaacccctctattccaaatgttctcagatggctgataatggagaaagatcacagcagtgttccaagttctaaagaggaactagacaaagaactcccagtgcttaagccatattttatcactaaccctgaagaagctggagtgagggaagctggcttaagagtcacatggctgggacatgccacggtaatggtggaaatggatgagctcatatttctcacggatcccatctttagctctcgtgcttcaccatcgcagtacatgggtccaaagcgatttcgtcgttccccgtgcacaataagtgaactccctccaatagatgcggtccttatcagtcacaaccactatgaccatctggactacaattctgtcattgctttgaatgagcgatttggtaatgagttgagatggtttgtgcctttgggtctccttgactggatgcaaaaatgtggctgtgagaatgtgattgagttggactggtgggaggagaattgtgtccccggacatgataaggtcacttttgtctttacaccttcccagcactggtgtaaaaggactctaatggatgacaacaaggtgctatggggcagctggtctgtcttggggccttggaatcgattttttttcgcaggagatactggttattgccctgcttttgaagagataggaaaaagatttggaccttttgaccttgcagctattcccatcggagcttatgaaccgaggtggtttatgaaataccagcatgtagacccagaagaagctgtaaggattcacactgatgtccaaacaaagaaatctatggcaattcactggggaacttttgccttagcaaatgagcattacttagagcctccagtgaagctgaatgaagctctagagagatacggacttaacgctgaagatttttttgtcttgaagcatggagaatcaagatacctaaataataatgatgaaaacttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein tyrosine phosphatase, non-receptor type 9 - major facilitator superfamily domain containing 5 - UDP glycosyltransferase 3 family, polypeptide A1 - differentially expressed in FDCP 8 homolog (mouse) |