PRUNE-prune homolog (Drosophila) Gene View larger

PRUNE-prune homolog (Drosophila) Gene

PTXBC063481

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRUNE-prune homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRUNE-prune homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063481
Product type: DNA & cDNA
Ncbi symbol: PRUNE
Origin species: Human
Product name: PRUNE-prune homolog (Drosophila) Gene
Size: 2ug
Accessions: BC063481
Gene id: 58497
Gene description: prune homolog (Drosophila)
Synonyms: prune exopolyphosphatase; protein prune homolog; PRUNE; H-PRUNE; DRES-17; DRES17; HTCD37; Drosophila-related expressed sequence 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagaaaagaccagaagactatctatagacaaggcgtcaaggtggccattagtgcaatatatatggatttggagatctgtgaagtcctggaacgctcccactctccacccctgaagctgacccctgcctcaagtacccaccctaacctccatgcctatcttcaaggcaacacccaggtctctcgaaagaaacttctgcccctgctccaggaagccctgtcagcatattttgactccatgaagatcccttcaggacagcctgagacagcagatgtgtccagggagcaagtggacaaggaattggacagggcaagtaactccctgatttctggactgagtcaagatgaggaggaccctccgctgcccccgacgcccatgaacagcttggtggatgagtgccctctagatcaggggctgcctaaactctctgctgaggccgtcttcgagaagtgcagtcagatctcactgtcacagtctaccacagcctccctgtccaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ciliary neurotrophic factor
- thiamin pyrophosphokinase 1
- guanylate binding protein 3
- ATPase, class V, type 10D

Reviews

Buy PRUNE-prune homolog (Drosophila) Gene now

Add to cart