Cart 38 Product Products 5 133,60 € (empty)
-
1 x SMPX-small...113,40 € -
1 x ZBTB24-zin...121,50 € -
1 x PTPRF-prot...121,50 € -
1 x NFIX-nucle...121,50 € -
1 x TERF2IP-te...121,50 € -
1 x STEAP3-STE...121,50 € -
1 x LOC348262-...113,40 € -
1 x HOMER1-hom...121,50 € -
1 x ENY2-enhan...113,40 € -
1 x KRAS-v-Ki-...113,40 € -
1 x DDI1-DDI1,...121,50 € -
1 x EFS-embryo...121,50 € -
1 x LOC554223-...113,40 € -
1 x CLNS1A-chl...113,40 € -
1 x GATA2-GATA...121,50 € -
1 x TUBA3D-tub...121,50 € -
1 x PLB1-phosp...121,50 € -
1 x AMBP-alpha...121,50 € -
1 x RPL26L1-ri...113,40 € -
1 x PSTPIP1-pr...121,50 € -
1 x MGC3771-hy...113,40 € -
1 x ALDH1A2-al...121,50 € -
1 x TMEM161B-t...121,50 € -
1 x DHX37-DEAH...113,40 € -
1 x C14orf135-...121,50 € -
1 x ADIG-adipo...113,40 € -
1 x Club Cell...594,00 € -
1 x SIRT6-sirt...113,40 € -
1 x PRDX6-pero...113,40 € -
1 x ZNF497-zin...121,50 € -
1 x PRUNE-prun...121,50 € -
1 x CAPN3-calp...113,40 € -
1 x SLC25A1-so...121,50 € -
1 x DPF3-D4,...121,50 € -
1 x IL17A-inte...113,40 € -
1 x ERGIC3-ERG...121,50 € -
1 x SPN-sialop...121,50 € -
No products
To be determined Shipping
5 133,60 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 38 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 133,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 133,60 €
Data sheet of ARHGAP24-Rho GTPase activating protein 24 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP24-Rho GTPase activating protein 24 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047918 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP24 |
| Origin species: | Human |
| Product name: | ARHGAP24-Rho GTPase activating protein 24 Gene |
| Size: | 2ug |
| Accessions: | BC047918 |
| Gene id: | 83478 |
| Gene description: | Rho GTPase activating protein 24 |
| Synonyms: | FILGAP; RC-GAP72; RCGAP72; p73; p73RhoGAP; rho GTPase-activating protein 24; RAC1- and CDC42-specific GTPase-activating protein of 72 kDa; filamin-A-associated RhoGAP; rhoGAP of 73 kDa; sarcoma antigen NY-SAR-88; Rho GTPase activating protein 24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagaacaatgactccacggagaacccccaacaaggccaagggcggcagaatgccatcaagtgtgggtggctgaggaagcaaggaggctttgtcaagacttggcatactcgctggtttgtgctcaagggggatcagctctattatttcaaagatgaagatgaaaccaagcccttgggtactatttttctgcctggaaataaagtttctgagcatccctgcaatgaagagaacccagggaagttcctttttgaagtagttccaggaggcgatcgagatcggatgacagcaaatcatgagagctacctcctcatggcaagcacccagaatgatatggaagactgggtgaagtcaatccgccgagtcatatggggacctttcggaggaggcatttttggacagaaactggaggatactgttcgttatgagaagagatatgggaaccgtctggctccgatgttggtggagcagtgcgtggactttatccgacaaagggggctgaaagaagagggtctctttcgactgccaggccaggctaatcttgttaaggagctccaagatgcctttgactgtggggagaagccatcatttgacagcaacacagatgtacacacggtggcatcacttcttaagctgtacctccgagaacttccagaaccagttattccttatgcgaagtatgaagattttttgtcatgtgccaaactgctcagcaaggaagaggaagcagtaagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - baculoviral IAP repeat-containing 8 - coiled-coil domain containing 74B - microfibrillar-associated protein 4 - trinucleotide repeat containing 6A |