Cart 5 Product Products 582,81 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 €
No products
To be determined Shipping
582,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 582,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 582,81 €
View larger 
Data sheet of BCL2L11-BCL2-like 11 (apoptosis facilitator) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCL2L11-BCL2-like 11 (apoptosis facilitator) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCL2L11 |
| Origin species: | Human |
| Product name: | BCL2L11-BCL2-like 11 (apoptosis facilitator) Gene |
| Size: | 2ug |
| Accessions: | BC033694 |
| Gene id: | 10018 |
| Gene description: | BCL2-like 11 (apoptosis facilitator) |
| Synonyms: | BAM; BOD; bcl-2-like protein 11; BCL2-like 11 (apoptosis facilitator); bcl-2 interacting mediator of cell death; bcl-2 interacting protein Bim; bcl-2-related ovarian death agonist; BCL2 like 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25, member 34 - chromosome 1 open reading frame 109 - chromosome 11 open reading frame 71 - chromosome 22 open reading frame 13 |