Cart 1 Product Products 113,40 € (empty)
-
1 x ZNF616-zin...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
DIP2A-DIP2 disco-interacting protein 2 homolog A (Drosophila) Gene
PTXBC046176
New product
Data sheet of DIP2A-DIP2 disco-interacting protein 2 homolog A (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DIP2A-DIP2 disco-interacting protein 2 homolog A (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046176 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DIP2A |
| Origin species: | Human |
| Product name: | DIP2A-DIP2 disco-interacting protein 2 homolog A (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC046176 |
| Gene id: | 23181 |
| Gene description: | DIP2 disco-interacting protein 2 homolog A (Drosophila) |
| Synonyms: | C21orf106; DIP2; disco-interacting protein 2 homolog A; DIP2 disco-interacting protein 2 homolog A; DIP2 homolog A; disco-interacting protein 2A; disco interacting protein 2 homolog A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggtaccaccccatcgacattgagacctctgtcatccgagcacacaggagcatcgctgagtgtgccgtattcacctggaccaacctgctggtggtggtggtggagctggatgggctagagcaggatgccctggacctggtggccctggtgaccaacgtggtgctggaggagcactacctggtcgtgggagtggtggtcatcgtggacccaggggtgatccctatcaactctcggggtgagaagcagcgcatgcacctgcgggacggcttcctggctgaccagctggaccccatctatgtcgcctacaacatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine palmitoyltransferase, long chain base subunit 1 - pseudouridylate synthase 7 homolog (S. cerevisiae)-like - potassium channel tetramerisation domain containing 18 - discs, large (Drosophila) homolog-associated protein 1 |