Cart 3 Product Products 340,20 € (empty)
-
1 x FGFBP2-fib...113,40 € -
1 x PF4V1-plat...113,40 € -
1 x C11orf17-c...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of TMEM14B-transmembrane protein 14B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM14B-transmembrane protein 14B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071660 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM14B |
| Origin species: | Human |
| Product name: | TMEM14B-transmembrane protein 14B Gene |
| Size: | 2ug |
| Accessions: | BC071660 |
| Gene id: | 81853 |
| Gene description: | transmembrane protein 14B |
| Synonyms: | transmembrane protein 14B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaagcccctcttcccattagtgcctttgcattggtttggctttggctacacagcactggttgtttctggtgggatcgttggctatgtaaaaacaggcagcgtgccgtccctggctgcagggctgctcttcggcagtctagccggcctgggtgcttaccagctgtatcaggatccaaggaacgtttggggtttcctagccgctacatctgttacttttgttggtgttatgggaatgagatcctactactatggaaaattcatgcctgtaggtttaattgcaggtgccagtttgctgatggccgccaaagttggagttcgtatgttgatgacatctgattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - shugoshin-like 2 (S. pombe) - mediator of cell motility 1 - histone cluster 1, H2ac - spindlin family, member 2A |