PTXBC035878
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC035878 |
Product type: | DNA & cDNA |
Ncbi symbol: | SLC2A5 |
Origin species: | Human |
Product name: | SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene |
Size: | 2ug |
Accessions: | BC035878 |
Gene id: | 6518 |
Gene description: | solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |
Synonyms: | GLUT-5; solute carrier family 2, facilitated glucose transporter member 5; glucose transporter type 5, small intestine; glucose transporter-like protein 5; solute carrier family 2 (facilitated glucose/fructose transporter), member 5; testicular tissue protein Li 81; solute carrier family 2 member 5 |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggagcaacaggatcagagcatgaaggaagggaggctgacgcttgtgcttgccctggcaaccctgatagctgcctttgggtcatccttccagtatgggtacaacgtggctgctgtcaactccccagcactgctcatgcaacaattttacaatgagacttactatggtaggaccggtgaattcatggaagacttccccttgacgttgctgtggtctgtaaccgtgtccatgtttccatttggagggtttatcggatccctcctggtcggccccttggtgaataaatttggcagaaaaggggccttgctgttcaacaacatattttctatcgtgcctgcgatcttaatgggatgcagcagagtcgccacatcatttgagcttatcattatttccagacttttggtgggaatatgtgcaggtgtatcttccaacgtggtccccatgtacttaggggagctggcccctaaaaacctgcggggggctctcggggtggtgccccagctcttcatcactgttggcatccttgtggcccagatctttggtcttcggaatctccttgcaaacgtagatggtgagttcaggacatctcgggagcacccccaccccttcaccactacccttggccccctccttgtgttccaaagccaccaccacaggacaggactttctgcagactggtctcttctaacaggctggatgtccttggggggcccatcctgtcccgagccaacatag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 - ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon - suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) |