Cart 35 Product Products 4 110,57 € (empty)
-
-
1 x PARP11-pol...113,40 € -
1 x MID1IP1-MI...113,40 € -
1 x CCDC90B-co...113,40 € -
1 x RAB3IL1-RA...121,50 € -
1 x FIBP-fibro...121,50 € -
1 x VHLL-von...113,40 € -
-
1 x TYROBP-TYR...113,40 € -
1 x UBE2L6-ubi...113,40 € -
1 x NCF1-neutr...121,50 € -
1 x KLK13-kall...121,50 € -
1 x NMUR2-neur...121,50 € -
1 x TAT-tyrosi...121,50 € -
-
1 x LYPLA2-lys...113,40 € -
1 x U2AF1-U2...113,40 € -
1 x MEMO1-medi...121,50 € -
1 x OLR1-oxidi...121,50 € -
1 x USP32-ubiq...121,50 € -
1 x MRPL18-mit...113,40 € -
1 x NME1-non-m...113,40 € -
1 x CD59-CD59...113,40 € -
1 x PSMB5-prot...113,40 € -
1 x PLEKHA9-pl...121,50 € -
1 x PAQR7-prog...121,50 € -
1 x LRP1-low...121,50 € -
1 x C19orf40-c...113,40 € -
1 x RBM33-RNA...121,50 € -
1 x PITX2-pair...121,50 € -
-
1 x SLC25A45-s...121,50 € -
1 x RAB4B-RAB4...113,40 € -
1 x ZMAT5-zinc...113,40 € -
1 x TFEC-trans...113,40 €
No products
To be determined Shipping
4 110,57 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 110,57 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 110,57 €
Data sheet of KLHL17-kelch-like 17 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLHL17-kelch-like 17 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045768 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLHL17 |
| Origin species: | Human |
| Product name: | KLHL17-kelch-like 17 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC045768 |
| Gene id: | 339451 |
| Gene description: | kelch-like 17 (Drosophila) |
| Synonyms: | kelch-like protein 17; actinfilin; kelch-like 17; kelch like family member 17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgagagccgccagacccacgtgacgctgcacgacatcgaccctcaggccttggaccagctggtgcagtttgcctacacggctgagattgtggtgggcgagggcaatgtgcagactctgctcccagccgccagtctcctgcagctgaatggcgtccgagacgcttgctgcaagtttctactgagtcagctcgacccctccaactgcctgggtatccggggctttgccgatgcccactcctgcagcgacctgctcaaggccgcccacaggtacgtgctgcagcacttcgtggacgtggccaagaccgaggagtttatgctgctgcccctgaaacaggtaacagctggcgggcccagccctcgccccccaccccaccccaccccagtctttgtctttgactcccgaccccgttttgttcctgacacagccctgcccacaatccttagtgcctgctgtgtgtccccgagaccttcctggatctgggccccccaggagcctcgtctgtggctcctgactctgctcggcccctcccagtatgaacactcagcccccacctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ataxia telangiectasia mutated - transmembrane protein 14B - shugoshin-like 2 (S. pombe) - mediator of cell motility 1 |