Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2R2D-protein phosphatase 2, regulatory subunit B, delta isoform Gene
PTXBC047379
New product
Data sheet of PPP2R2D-protein phosphatase 2, regulatory subunit B, delta isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2R2D-protein phosphatase 2, regulatory subunit B, delta isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC047379 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2R2D |
| Origin species: | Human |
| Product name: | PPP2R2D-protein phosphatase 2, regulatory subunit B, delta isoform Gene |
| Size: | 2ug |
| Accessions: | BC047379 |
| Gene id: | 55844 |
| Gene description: | protein phosphatase 2, regulatory subunit B, delta isoform |
| Synonyms: | MDS026; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform; PP2A subunit B isoform B55-delta; PP2A subunit B isoform PR55-delta; PP2A subunit B isoform R2-delta; PP2A subunit B isoform delta; protein phosphatase 2 regulatory subunit B, delta; protein phosphatase 2, regulatory subunit B, delta isoform; protein phosphatase 2 regulatory subunit Bdelta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggagccggaggcggcggctgccccgcgggcggcaacgacttccagtggtgcttctcgcaggtcaagggggccatcgacgaggacgtggccgaagcggacatcatttccaccgttgagtttaattactctggagatcttcttgcaacaggagacaagggcggcagagttgttatttttcagcgtgaacaagagaataaaagccgccctcattctaggggagaatataatgtttacagcacctttcaaagtcatgaaccggagtttgactatttgaaaagtctagaaattgaggaaaaaattaataaaattaggtggttaccacaacagaatgctgctcattttctactgtctacaaatgataaaactataaaattatggaaaataagtgaacgggataaaagagcagaaggttataacctgaaagacgaagatggaagacttcgagacccatttaggatcacggcgctacgggtcccaatattgaagcccatggatcttatggtagaagcgagtccacggcgaatttttgcaaatgctcacacatatcatataaattccatttcagtaaatagtgatcatgaaacatatctttctgcagatgacctgagaattaatttatggcacttagaaatcacagatagaagctttaacatcgtggacatcaagcctgctaacatggaggagctgaccgaagtcatcactgcagccgagttccacccgcaccagtgcaacgtgttcgtctacagcagtagcaaagggaccatccgcctgtgtgacatgcgctcctcggccctgtgcgacagacactccaagttttttgaagagcctgaagatcccagcagtaggtccttcttctcagaaataatttcatccatatccgatgtaaaattcagtcatagtgggcggtacatgatgaccagagactacctgtcggtgaaggtgtgggacctcaacatggagagcaggccggtggagacccaccaggtccacgagtacctgcgcagcaagctctgctctctctatgagaacgactgcatctttgacaagtttgagtgttgctggaacggttcggatagcgccatcatgaccgggtcctataacaacttcttcaggatgtttgatagagacacgcggagggatgtgaccctggaggcctcgagagagagcagcaaaccgcgcgccagcctcaaaccccggaaggtgtgtacggggggtaagcggaggaaagacgagatcagtgtggacagtctggacttcaacaagaagatcctgcacacagcctggcaccccgtggacaatgtcattgccgtggctgccaccaataacttgtacatattccaggacaaaatcaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poliovirus receptor related immunoglobulin domain containing - proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 - ankyrin repeat and sterile alpha motif domain containing 1B - proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |