Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of AKAP13-A kinase (PRKA) anchor protein 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKAP13-A kinase (PRKA) anchor protein 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050312 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKAP13 |
| Origin species: | Human |
| Product name: | AKAP13-A kinase (PRKA) anchor protein 13 Gene |
| Size: | 2ug |
| Accessions: | BC050312 |
| Gene id: | 11214 |
| Gene description: | A kinase (PRKA) anchor protein 13 |
| Synonyms: | AKAP-13; AKAP-Lbc; ARHGEF13; BRX; HA-3; Ht31; LBC; PRKA13; PROTO-LB; PROTO-LBC; c-lbc; p47; A-kinase anchor protein 13; A kinase (PRKA) anchor protein 13; A-kinase anchoring protein; LBC oncogene; breast cancer nuclear receptor-binding auxiliary protein; guanine nucleotide exchange factor Lbc; human thyroid-anchoring protein 31; lymphoid blast crisis oncogene; non-oncogenic Rho GTPase-specific GTP exchange factor; protein kinase A-anchoring protein 13; A-kinase anchoring protein 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaacttaatccacagcaagctcccttatatggtgattgtgttgttacagtgctgcttgctgaagaggacaaagctgaagatgatgtagtgttttacttggtatttttgggttccaccctccgtcactgtacaagtactcggaaggtcagttctgatacattggagaccattgctcctggtcatgattgttgtgaaacagtgaaggtgcagctctgtgcttccaaagagggccttcccgtgtttgtggtggctgaagaagactttcatttcgtccaggatgaagcgtatgatgcagctcaattcctagcaaccagtgctggaaatcagcaggctttgaactttacccgttttcttgaccagtcaggacccccatctggggatgtgaattcccttgataagaagttggtgctggcattcaggcacctgaagctgcccacggagtggaatgtattggggacagatcagagtttgcatggtgagaatttatatgatctacaaacacactttaagtttgtgatatttctactttttttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetratricopeptide repeat domain 32 - zinc finger, C3H1-type containing - leucine rich repeat containing 25 - tetratricopeptide repeat domain 25 |