Cart 8 Product Products 1 535,41 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 € -
-
-
1 x Free Estriol399,00 € -
1 x SNRPE-smal...113,40 € -
1 x BUB3-buddi...121,50 € -
1 x ATXN7L3-at...121,50 €
No products
To be determined Shipping
1 535,41 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 535,41 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 535,41 €
View larger 
Data sheet of HNRPLL-heterogeneous nuclear ribonucleoprotein L-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HNRPLL-heterogeneous nuclear ribonucleoprotein L-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008217 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HNRPLL |
| Origin species: | Human |
| Product name: | HNRPLL-heterogeneous nuclear ribonucleoprotein L-like Gene |
| Size: | 2ug |
| Accessions: | BC008217 |
| Gene id: | 92906 |
| Gene description: | heterogeneous nuclear ribonucleoprotein L-like |
| Synonyms: | HNRPLL; SRRF; heterogeneous nuclear ribonucleoprotein L-like; heterogeneous nuclear ribonucleoprotein L like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttggctcgggagacgtacgaggaggaccgggagtacgagagccaggccaagcgtctcaagaccgaggagggggagatcgactactcggccgaggaaggcgagaaccgccgggaagcgacgccccggggcgggggcgatggcggcggcggcggccggagcttctctcagccggaggcaggtggaagtcatcataaagtttctgtttcacccgtcgtccatgttcgaggactctgtgaatctgtggtggaagcagacctcgtggaagcgctggaaaaatttgggacaatatgctatgtgatgatgatgccatttaaacgacaggctctagtggaatttgaaaacatagatagtgccaaagaatgtgtgacatttgctgcagatgaacccgtgtacattgctggtcaacaggcttttttcaactattctacaagcaaaaggatcactcggccaggaaatactgatgatccatcaggaggcaacaaagttcttctgctctcaattcagaatccgctttatccaattacagtggatgttttatatactgtatgcaaccctgttggcaaagtgcaacgtattgttatattcaagagaaatgggatacaagcaatggttgagtttgaatcagtcctttgtgcccagaaagctaaagcagcactcaatggagctgatatatatgctggatgttgcacactaaaaattgaatatgcacggccaactcgtctaaatgttattaggaatgacaatgacagttgggactacactaaaccatatttgggaagacgaggtaggtattttatacattttagaatgtacttgatctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amiloride-sensitive cation channel 4, pituitary - progestin and adipoQ receptor family member III - nuclear receptor subfamily 2, group C, member 2 - purinergic receptor P2Y, G-protein coupled, 11 |