Cart 45 Product Products 5 939,89 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
-
1 x ORC4L-orig...113,40 € -
1 x RBPMS-RNA...113,40 € -
1 x MAP2K5-mit...121,50 € -
1 x HLA-DRB3-m...121,50 € -
1 x GATC-gluta...113,40 € -
1 x C7orf44-ch...113,40 € -
1 x APOM-apoli...113,40 € -
1 x PNPLA1-pat...121,50 € -
1 x TPPP-tubul...113,40 € -
1 x BARX1-BARX...113,40 € -
1 x DDA1-DET1...113,40 € -
1 x FGFRL1-fib...121,50 € -
1 x IFNW1-inte...113,40 € -
1 x GSTA4-glut...113,40 € -
1 x PI4KAP1-ph...113,40 € -
-
-
1 x ANKS1B-ank...121,50 € -
1 x JTV1-JTV1...121,50 € -
1 x PPP4R1L-pr...121,50 € -
-
1 x ANXA8L2-an...121,50 €
No products
To be determined Shipping
5 939,89 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 45 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 939,89 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 939,89 €
Data sheet of GPR101-G protein-coupled receptor 101 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR101-G protein-coupled receptor 101 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC069439 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR101 |
| Origin species: | Human |
| Product name: | GPR101-G protein-coupled receptor 101 Gene |
| Size: | 2ug |
| Accessions: | BC069439 |
| Gene id: | 83550 |
| Gene description: | G protein-coupled receptor 101 |
| Synonyms: | GPCR6; PAGH2; G protein-coupled receptor 101 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgtccacctgcaccaacagcacgcgcgagagtaacagcagccacacgtgcatgcccctctccaaaatgcccatcagcctggcccacggcatcatccgctcaaccgtgctggttatcttcctcgccgcctctttcgtcggcaacatagtgctggcgctagtgttgcagcgcaagccgcagctgctgcaggtgaccaaccgttttatctttaacctcctcgtcaccgacctgctgcagatttcgctcgtggccccctgggtggtggccacctctgtgcctctcttctggcccctcaacagccacttctgcacggccctggttagcctcacccacctgttcgccttcgccagcgtcaacaccattgtcgtggtgtcagtggatcgctacttgtccatcatccaccctctctcctacccgtccaagatgacccagcgccgcggttacctgctcctctatggcacctggattgtggccatcctgcagagcactcctccactctacggctggggccaggctgcctttgatgagcgcaatgctctctgctccatgatctggggggccagccccagctacactattctcagcgtggtgtccttcatcgtcattccactgattgtcatgattgcctgctactccgtggtgttctgtgcagcccggaggcagcatgctctgctgtacaatgtcaagagacacagcttggaagtgcgagtcaaggactgtgtggagaatgaggatgaagagggagcagagaagaaggaggagttccaggatgagagtgagtttcgccgccagcatgaaggtgaggtcaaggccaaggagggcagaatggaagccaaggacggcagcctgaaggccaaggaaggaagcacggggaccagtgagagtagtgtagaggccaggggcagcgaggaggtcagagagagcagcacggtggccagcgacggcagcatggagggtaaggaaggcagcaccaaagttgaggagaacagcatgaaggcagacaagggtcgcacagaggtcaaccagtgcagcattgacttgggtgaagatgacatggagtttggtgaagacgacatcaatttcagtgaggatgacgtcgaggcagtgaacatcccggagagcctcccacccagtcgtcgtaacagcaacagcaaccctcctctgcccaggtgctaccagtgcaaagctgctaaagtgatcttcatcatcattttctcctatgtgctatccctggggccctactgctttttagcagtcctggccgtgtgggtggatgtcgaaacccaggtaccccagtgggtgatcaccataatcatctggcttttcttcctgcagtgctgcatccacccctatgtctatggctacatgcacaagaccattaagaaggaaatccaggacatgctgaagaagttcttctgcaaggaaaagcccccgaaagaagatagccacccagacctgcccggaacagagggtgggactgaaggcaagattgtcccttcctacgattctgctacttttccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAS-like, family 10, member A - molybdenum cofactor synthesis 1 - ubiquitin specific peptidase 37 - TBC1 domain family, member 3C |