Cart 7 Product Products 2 821,78 € (empty)
-
1 x TNF-beta494,00 € -
1 x Trefoil...644,00 € -
1 x Testosterone544,00 € -
-
1 x TIMP-1494,00 € -
1 x TNF-alpha...494,00 € -
1 x TSH...49,00 €
No products
To be determined Shipping
2 821,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 821,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 821,78 €
View larger 
VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
PTXBC000880
New product
Data sheet of VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000880 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS29 |
| Origin species: | Human |
| Product name: | VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000880 |
| Gene id: | 51699 |
| Gene description: | vacuolar protein sorting 29 homolog (S. cerevisiae) |
| Synonyms: | VPS29, retromer complex component; vacuolar sorting protein VPS29/PEP11; DC15; DC7; PEP11; vacuolar protein sorting-associated protein 29; PEP11 homolog; hVPS29; retromer protein; vacuolar protein sorting 29 homolog; vesicle protein sorting 29; x 007 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgggcacagattggtgttggtattaggagatctgcacatcccacaccggtgcaacagtttgccagctaaattcaaaaaactcctggtgccaggaaaaattcagcacattctctgcacaggaaacctttgcaccaaagagagttatgactatctcaagactctggctggtgatgttcatattgtgagaggagacttcgatgagaatctgaattatccagaacagaaagttgtgactgttggacagttcaaaattggtctgatccatggacatcaagttattccatggggagatatggccagcttagccctgttgcagaggcaatttgatgtggacattcttatctcgggacacacacacaaatttgaagcatttgagcatgaaaataaattctacattaatccaggttctgccactggggcatataatgccttggaaacaaacattattccatcatttgtgttgatggatatccaggcttctacagtggtcacctatgtgtatcagctaattggagatgatgtgaaagtagaacgaatcgaatacaaaaaaccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP-binding cassette, sub-family A (ABC1), member 8 - ATP-binding cassette, sub-family A (ABC1), member 9 - dishevelled associated activator of morphogenesis 2 - actin related protein 2/3 complex, subunit 3, 21kDa |