CLEC10A-C-type lectin domain family 10, member A Gene View larger

CLEC10A-C-type lectin domain family 10, member A Gene

PTXBC027858

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC10A-C-type lectin domain family 10, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC10A-C-type lectin domain family 10, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027858
Product type: DNA & cDNA
Ncbi symbol: CLEC10A
Origin species: Human
Product name: CLEC10A-C-type lectin domain family 10, member A Gene
Size: 2ug
Accessions: BC027858
Gene id: 10462
Gene description: C-type lectin domain family 10, member A
Synonyms: CD301; CLECSF13; CLECSF14; HML; HML2; MGL; C-type lectin domain family 10 member A; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13 (macrophage-derived); C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 14 (macrophage-derived); macrophage lectin 2 (calcium dependent)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaaggacgtatgaaaacttccagtacttggagaataaggtgaaagtccaggggtttaaaaatgggccacttcctctccagtccctcctgcagcgtctccgctctgggccctgccatctcctgctgtccctgggcctcggcctgctgctgctggtcatcatctgtgtggttggattccaaaattccaaatttcagagggacctggtgaccctgagaacagattttagcaacttcacctcaaacactgtggcggagatccaggcactgacttcccagggcagcagcttggaagaaacgatagcatctctgaaagctgaggtggagggtttcaggcaggaacggcaggcagttcattctgaaatgctcctgcgagtccagcagctggtgcaagacctgaagaaactgacctgccaggtggctactctcaacaacaatgcctccactgaagggacctgctgccccgtcaactgggtggagcaccaagacagctgctactggttctctcactctgggatgtcctgggccgaggctgagaagtactgccagctgaagaacgcccacctggtggtcatcaactccagggaggagcaggtgagggcttctggtactcagttcctaagacatgtcccatttagggaaatggttcttaagcttggccgcacattggaatcatctgggagcttccagaatgactgtcatctgtgccacaccctcagagatttaataggcctgagcatccagagaaacatctccaaactcctcagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit IV isoform 1
- enhancer of polycomb homolog 1 (Drosophila)
- FERM and PDZ domain containing 2 like 2
- discoidin domain receptor tyrosine kinase 1

Reviews

Buy CLEC10A-C-type lectin domain family 10, member A Gene now

Add to cart