Cart 1 Product Products 121,50 € (empty)
-
1 x AURKB-auro...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
SNRNP35-small nuclear ribonucleoprotein 35kDa (U11/U12) Gene
PTXBC009622
New product
Data sheet of SNRNP35-small nuclear ribonucleoprotein 35kDa (U11/U12) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRNP35-small nuclear ribonucleoprotein 35kDa (U11/U12) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009622 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRNP35 |
| Origin species: | Human |
| Product name: | SNRNP35-small nuclear ribonucleoprotein 35kDa (U11/U12) Gene |
| Size: | 2ug |
| Accessions: | BC009622 |
| Gene id: | 11066 |
| Gene description: | small nuclear ribonucleoprotein 35kDa (U11/U12) |
| Synonyms: | HM-1; U1SNRNPBP; U11/U12 small nuclear ribonucleoprotein 35 kDa protein; U1 snRNP-binding protein homolog; U11/U12 snRNP 35 kDa protein; U11/U12 snRNP 35K; U11/U12-35K; protein HM-1; small nuclear ribonucleoprotein 35kDa (U11/U12); small nuclear ribonucleoprotein, U11/U12 35kDa subunit; small nuclear ribonucleoprotein U11/U12 subunit 35 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaccagctaacatgaacgattggatgcccatcgccaaggagtatgatccactcaaagcgggcagcattgatggcaccgatgaagacccacacgaccgcgcggtctggagggcaatgctggcacgatatgtccccaacaaaggtgtcataggagatcccctcctcaccctgtttgtggccagactaaacttgcagaccaaggaggacaaattaaaggaagtcttttcccgctatggtgacatccggcggcttcggctggtcagggacttggtcacaggtttttcaaagggctacgccttcatcgaatacaaggaggagcgtgccgtgatcaaagcttaccgagatgctgatggcctggttattgaccagcatgagatatttgtggactacgagctggaaaggactctcaaagggtggatccctcggcgacttggaggcggtcttgggggaaaaaaggagtctgggcaactgagatttgggggacgggaccggccttttcgaaaacctattaacttgccagttgttaaaaacgacctctatagagagggaaaacgggaaaggcgggagcgatctcgatcccgagaaagacactgggactcgaggacaagggatcgagaccatgacaggggccgggagaagagatggcaagaaagagagccgaccagggtgtggcccgacaatgactgggagagagagagggacttcagagatgacaggatcaaggggagggagaagaaggaaagaggcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-mos Moloney murine sarcoma viral oncogene homolog - N-acyl phosphatidylethanolamine phospholipase D - protein tyrosine phosphatase, non-receptor type 9 - major facilitator superfamily domain containing 5 |