Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RCHY1-ring finger and CHY zinc finger domain containing 1 Gene
PTXBC031057
New product
Data sheet of RCHY1-ring finger and CHY zinc finger domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCHY1-ring finger and CHY zinc finger domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031057 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCHY1 |
| Origin species: | Human |
| Product name: | RCHY1-ring finger and CHY zinc finger domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC031057 |
| Gene id: | 25898 |
| Gene description: | ring finger and CHY zinc finger domain containing 1 |
| Synonyms: | ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363; RING finger and CHY zinc finger domain-containing protein 1; CH-rich interacting match with PLAG1; E3 ubiquitin-protein ligase Pirh2; RING finger protein 199; androgen-receptor N-terminal-interacting protein; p53-induced protein with a RING-H2 domain; ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase; zinc finger protein 363; zinc finger, CHY-type; ring finger and CHY zinc finger domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgacggcccgggaagatggcgccagcggtcaagagcgaggtcagcggggctgcgagcactatgacagaggatgtctcctaaaggcaccttgctgtgacaagctttatacttgccgcttgtgtcatgataacaatgaagatcatcaactagatcgctttaaagtgaaggaagtgcagtgcataaactgtgaaaaaattcaacatgcccaacagacttgtgaagaatgtagcacattgtttggagaatattattgcgatatatgccatttgtttgacaaagataagaagcagtatcactgtgaaaactgtggaatttgtaggattggtccaaaggaagattttttccattgtttgaaatgtaacttatgcctagctatgaatcttcaaggaagacacaagtgtattgaaaatgtgtcccgacagaattgtccaatatgtttggaggacattcacacatcccgtgttgttgctcatgtcttgccatgtggacatcttttacataggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 29 homolog (S. cerevisiae) - ATP-binding cassette, sub-family A (ABC1), member 8 - ATP-binding cassette, sub-family A (ABC1), member 9 - dishevelled associated activator of morphogenesis 2 |