FA2H-fatty acid 2-hydroxylase Gene

View larger

FA2H-fatty acid 2-hydroxylase Gene

Reference: PTXBC010453

Condition: New product

Print

Data sheet of FA2H-fatty acid 2-hydroxylase Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about FA2H-fatty acid 2-hydroxylase Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC010453
Product type:	DNA & cDNA
Ncbi symbol:	FA2H
Origin species:	Human
Product name:	FA2H-fatty acid 2-hydroxylase Gene
Size:	2ug
Accessions:	BC010453
Gene id:	79152
Gene description:	fatty acid 2-hydroxylase
Synonyms:	FAAH; FAH1; FAXDC1; SCS7; SPG35; fatty acid 2-hydroxylase; fatty acid alpha-hydroxylase; fatty acid hydroxylase domain containing 1; spastic paraplegia 35 (autosomal recessive)
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgcccaagcctctccatctgcaggcacccttcgacggctcccgcctggtcttcccccctgtgccagcctccctggtgatcggcgtcttctacttgtgcatgcagctcatcctgcctgaggcagtagggggcactgtgtttgcggggggcctcctgggctacgtcctctatgacatgacccattactacctgcactttggctcgccgcacaagggctcctacctgtacagcctgaaggcccaccacgtcaagcaccactttgcacatcagaagtcaggatttggtatcagcactaaattgtgggattactgtttccacaccctcactccagagaaaccccacctgaagacgcagtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- dickkopf-like 1 (soggy) - ADAM-like, decysin 1 - aryl hydrocarbon receptor - centromere protein C 1

Reviews

Be the first to write your review !

Buy FA2H-fatty acid 2-hydroxylase Gene now