Cart 35 Product Products 4 699,32 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x ZPBP-zona...121,50 € -
1 x DUSP26-dua...113,40 € -
1 x GCSH-glyci...113,40 € -
1 x PLEKHO2-pl...121,50 € -
1 x MMP13-matr...121,50 € -
1 x BST2-bone...113,40 € -
1 x SURF6-surf...121,50 € -
1 x RPS16-ribo...113,40 € -
1 x RPL13-ribo...113,40 € -
1 x RPSA-ribos...121,50 € -
1 x LRP3...259,07 € -
1 x DCI-dodece...113,40 € -
1 x GINS2-GINS...113,40 € -
1 x TUBA3E-tub...121,50 € -
1 x TMEM183A-t...121,50 € -
1 x BBOX1-buty...121,50 € -
1 x SLC17A5-so...121,50 € -
1 x GBA3-gluco...113,40 € -
1 x GATA-2/3...259,07 € -
1 x LRP1...259,07 € -
1 x KIR2DL3-ki...121,50 € -
1 x LAPTM4B-ly...113,40 € -
1 x PTPN11-pro...121,50 € -
1 x GIPC3-GIPC...121,50 € -
-
1 x DYNLRB1-dy...113,40 €
No products
To be determined Shipping
4 699,32 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 699,32 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 699,32 €
View larger 
Data sheet of PAK2-p21 protein (Cdc42/Rac)-activated kinase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAK2-p21 protein (Cdc42/Rac)-activated kinase 2 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC069613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAK2 |
| Origin species: | Human |
| Product name: | PAK2-p21 protein (Cdc42/Rac)-activated kinase 2 Gene |
| Size: | 2ug |
| Accessions: | BC069613 |
| Gene id: | 5062 |
| Gene description: | p21 protein (Cdc42/Rac)-activated kinase 2 |
| Synonyms: | PAK65; PAKgamma; serine/threonine-protein kinase PAK 2; PAK-2; S6/H4 kinase; gamma-PAK; p21 (CDKN1A)-activated kinase 2; p21 protein (Cdc42/Rac)-activated kinase 2; p21-activated kinase 2; p58; p21 (RAC1) activated kinase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgataacggagaactggaagataagcctccagcacctcctgtgcgaatgagcagcaccatctttagcactggaggcaaagaccctttgtcagccaatcacagtttgaaacctttgccctctgttccagaagagaaaaagcccaggcataaaatcatctccatattctcaggcacagagaaaggaagtaaaaagaaggaaaaggaacggccagaaatttctcctccatctgattttgagcacaccatccatgttggttttgatgctgttactggagaattcactggcatgccagaacagtgggctcgattactacagacctccaatatcaccaaactagagcaaaagaagaaccctcaggctgtgctggatgtcctaaagttctacgactccaacacagtgaagcagaaatatctgagctttactcctcctgagaaagatggctttccttctggaacaccagcactgaatgccaagggaacagaagcacccgcagtagtgacagaggaggaggatgatgatgaagagactgctcctcccgttattgccccgcgaccggatcatacgaaatcaatttacacacggtctgtaattgaccctgttcctgcaccagttggtgattcacatgttgatggtgctgccaagtctttagacaaacagaaaaagaagactaagatgacagatgaagagattatggagaaattaagaactatcgtgagcataggtgaccctaagaaaaaatatacaagatatgaaaaaattggacaaagggcttctggtacagttttcactgctactgacgttgcactgggacaggaggttgctatcaaacaaattaatttacagaaacagccaaagaaggaactgatcattaacgagattctggtgatgaaagaattgaaaaatcccaacatcgttaactttttggacagttacctggtaggagatgaattgtttgtggtcatggaataccttgctggggggtcactcactgatgtggtaacagaaacgtgcatggatgaagcacagattgctgctgtatgcagagagtgtttacaggcattggagtttttacatgctaatcaagtgatccacagagacatcaaaagtgacaatgtacttttgggaatggaaggatctgttaagctcactgactttggtttctgtgcccagatcacccctgagcagagcaaacgcagtaccatggtcggaacgccatactggatggcaccagaggtggttacacggaaagcttatggccctaaagtcgacatatggtctctgggtatcatggctattgagatggtagaaggagagcctccatacctcaatgaaaatcccttgagggccttgtacctaatagcaactaatggaaccccagaacttcagaatccagagaaactttccccaatatttcgggatttcttaaatcgatgtttggaaatggatgtggaaaaaaggggttcagccaaagaattattacagcatcctttcctgaaactggccaaaccgttatctagcttgacaccactgatcatggcagctaaagaagcaatgaagagtaaccgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - A kinase (PRKA) anchor protein (yotiao) 9 - LIM homeobox transcription factor 1, beta - zinc finger and SCAN domain containing 1 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 |