Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LYSMD1-LysM, putative peptidoglycan-binding, domain containing 1 Gene
PTXBC031649
New product
Data sheet of LYSMD1-LysM, putative peptidoglycan-binding, domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LYSMD1-LysM, putative peptidoglycan-binding, domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031649 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LYSMD1 |
| Origin species: | Human |
| Product name: | LYSMD1-LysM, putative peptidoglycan-binding, domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC031649 |
| Gene id: | 388695 |
| Gene description: | LysM, putative peptidoglycan-binding, domain containing 1 |
| Synonyms: | SB145; lysM and putative peptidoglycan-binding domain-containing protein 1; LysM, putative peptidoglycan-binding, domain containing 1; RP11-68I18.5; LysM domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccccgtctagacagcccccgccaggggggtcaggactgcttcaagggagccgggctcgttcatatggaagcctggtgcaatcggcctgctccccagtgagggaaagacgcctggagcatcagttggagcccggagacaccctggctggactagcactcaaatatggggtgacgatggaacagattaaacgtgcaaaccgcctttatactaatgactccatcttcctgaagaaaaccctctacatccccatcctgacagagcccagagacctgttcaatggtttggactctgaggaagagaaagatggagaggaaaaagtacacccaagtaacagtgaagtttggccacactcaactgagaggaagaaacaagagacaggagcaggacgtgccaatggtgaagtcctccccacacctggccaggaaacccccacgcccatccatgacctctctgcctctgatttccttaagaagcttgattcacagatcagcctgtccaagaaggctgctgctcagaagctgaaaaaaggggaaaatggggtacctggggaggatgcaggtctccacctgagctccccttggatgcagcaacgagcagtcctaggtcctgtgccgctgacccgtacctctcggacccggacactacgggaccaggaggatgaaatcttcaaactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inturned planar cell polarity effector homolog (Drosophila) - myosin, light chain 6, alkali, smooth muscle and non-muscle - signaling lymphocytic activation molecule family member 1 - regulatory factor X, 3 (influences HLA class II expression) |