KIF9-kinesin family member 9 Gene

View larger

KIF9-kinesin family member 9 Gene

Reference: PTXBC015311

Condition: New product

Print

Data sheet of KIF9-kinesin family member 9 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about KIF9-kinesin family member 9 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC015311
Product type:	DNA & cDNA
Ncbi symbol:	KIF9
Origin species:	Human
Product name:	KIF9-kinesin family member 9 Gene
Size:	2ug
Accessions:	BC015311
Gene id:	64147
Gene description:	kinesin family member 9
Synonyms:	kinesin-like protein KIF9; kinesin protein 9; kinesin family member 9
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgggtactaggaaaaaagttcatgcatttgtccgtgtcaaacccaccgatgactttgctcatgaaatgatcagatacggagatgacaaaagaagcattgatattcacttaaaaaaagacattcggagaggagttgtcaataaccaacagacagactggtcgtttaagttggatggagttcttcacgatgcctcccaggacttggtttatgagacagttgcaaaggatgtggtttctcaggccctcgatggctataatggtaacttaattaattaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- melanocortin 3 receptor - olfactomedin-like 2B - RuvB-like 2 (E. coli) - ankyrin 1, erythrocytic

Reviews

Be the first to write your review !

Buy KIF9-kinesin family member 9 Gene now