PTXBC031871
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC031871 |
Product type: | DNA & cDNA |
Ncbi symbol: | CSMD2 |
Origin species: | Human |
Product name: | CSMD2-CUB and Sushi multiple domains 2 Gene |
Size: | 2ug |
Accessions: | BC031871 |
Gene id: | 114784 |
Gene description: | CUB and Sushi multiple domains 2 |
Synonyms: | dJ1007G16.1; dJ1007G16.2; dJ947L8.1; CUB and sushi domain-containing protein 2; CUB and Sushi (SCR repeat) domain; CUB and sushi multiple domains protein 2; CUB and Sushi multiple domains 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtgtgatgcccaccttcgaggcccctcgggcatcatcacctcccccaatttccccattcagtatgacaacaatgcacactgtgtgtggatcatcacagcactcaacccctccaaggtgggaggagacccagggaacatacaatgcaacaaggagggtctaagtgtggaaactcaaagtctaagactgaggaatagaagttgtcttctgggaaacagcaaggacaatggatgctgtgtgcctaaccctgttcatggaactggcctacaggtgatcaagctcgcctttgaggagtttgatttggagaggggctatgacaccctgacggtcggtgatggtggtcaggatggggaccagaagacagttctctacatcctgacaggtacatcggtcccggatctcattgtcagcaccaatcatcaaatgtggctcctcttccagactgatggcagtggcagttccctgggattcaaggcttcttatgaagagatcgagcagggcagttgcggtgaccctggcatacctgcatatggccggagggaaggctcccggtttcaccacggtgacacactcaagtttgagtgccagcccgcctttgagctggtgggacagaaggcaatcacatgccaaaagaataaccaatggtcggctaagaagccaggctgcgtgtgtaagtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - SEC31 homolog B (S. cerevisiae) - activating transcription factor 7 - lipoxygenase homology domains 1 - A kinase (PRKA) anchor protein 8 |