POFUT2-protein O-fucosyltransferase 2 Gene

View larger

POFUT2-protein O-fucosyltransferase 2 Gene

Reference: PTXBC011044

Condition: New product

Print

Data sheet of POFUT2-protein O-fucosyltransferase 2 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about POFUT2-protein O-fucosyltransferase 2 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC011044
Product type:	DNA & cDNA
Ncbi symbol:	POFUT2
Origin species:	Human
Product name:	POFUT2-protein O-fucosyltransferase 2 Gene
Size:	2ug
Accessions:	BC011044
Gene id:	23275
Gene description:	protein O-fucosyltransferase 2
Synonyms:	FUT13; GDP-fucose protein O-fucosyltransferase 2; O-FucT-2; peptide-O-fucosyltransferase 2; protein O-fucosyltransferase 2
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggtgtttgccaggcacctgcgggaggtgggagacgagttcaggagcagacatctcaactccacggacgacgcagacaggatccccttccaggaggactggatgaagatgaaggtcaagctgggctccgcgctagggggcccctacctgggagtccacctgagaagaaaagatttcatctggggtcacagacaggatgtacccagtctggaaggggccgtgaggaagatccgcagcctcatgaagacccaccggctggacaaggtgtttgtggccacagatgccgtcagaaaggaatatgaagagctaaaaaagctgttacccgagatggtgaggtttgaacccacgtgggaggagctggagctctacaaggacggaggcgttgcgattattgaccagtggatctgcgcacacgccagttcatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- chemokine (C-C motif) receptor 9 - tripartite motif-containing 46 - G protein-coupled receptor 101 - RAS-like, family 10, member A

Reviews

Be the first to write your review !

Buy POFUT2-protein O-fucosyltransferase 2 Gene now