Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031560 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IMPA2 |
| Origin species: | Human |
| Product name: | IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene |
| Size: | 2ug |
| Accessions: | BC031560 |
| Gene id: | 3613 |
| Gene description: | inositol(myo)-1(or 4)-monophosphatase 2 |
| Synonyms: | inositol monophosphatase 2; IMP 2; IMPase 2; inosine monophosphatase 2; inositol monophosphatase 2 variant 1; inositol monophosphatase 2 variant 2; inositol(myo)-1(or 4)-monophosphatase 2; myo-inositol monophosphatase 2; myo-inositol monophosphatase A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagccgagcggcgaggaccaggcggcgctggcggccggcccctgggaggagtgcttccaggcggccgtgcagctggcgctgcgggcaggacagatcatcagaaaagcccttactgaggaaaaacgtgtctcaacaaaaacatcagctgcagatcttgtgacagaaacagatcaccttgtggaagatttaattatttctgagttgcgagagaggtttccttcacacaggtctcctttttctctagtacacatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GATA zinc finger domain containing 2B - glutamate receptor, ionotrophic, AMPA 4 - piggyBac transposable element derived 3 - piggyBac transposable element derived 2 |