Cart 1 Product Products 544,00 € (empty)
-
1 x C-Reactive...544,00 €
No products
To be determined Shipping
544,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 544,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 544,00 €
Data sheet of IL25-interleukin 25 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL25-interleukin 25 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069565 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL25 |
| Origin species: | Human |
| Product name: | IL25-interleukin 25 Gene |
| Size: | 2ug |
| Accessions: | BC069565 |
| Gene id: | 64806 |
| Gene description: | interleukin 25 |
| Synonyms: | IL17E; interleukin-25; interleukin-17E; interleukin 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggagcgacccagattaggtgaggacagttctctcattagccttttcctacaggtggttgcattcttggcaatggtcatgggaacccacacctacagccactggcccagctgctgccccagcaaagggcaggacacctctgaggagctgctgaggtggagcactgtgcctgtgcctcccctagagcctgctaggcccaaccgccacccagagtcctgtagggccagtgaagatggacccctcaacagcagggccatctccccctggagatatgagttggacagagacttgaaccggctcccccaggacctgtaccacgcccgttgcctgtgcccgcactgcgtcagcctacagacaggctcccacatggacccccggggcaactcggagctgctctaccacaaccagactgtcttctacaggcggccatgccatggcgagaagggcacccacaagggctactgcctggagcgcaggctgtaccgtgtttccttagcttgtgtgtgtgtgcggccccgtgtgatgggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - homeobox D10 - LIM homeobox 8 - interleukin 21 - interleukin 21 |