RGS8-regulator of G-protein signaling 8 Gene

View larger

RGS8-regulator of G-protein signaling 8 Gene

Reference: PTXBC069718

Condition: New product

Print

Data sheet of RGS8-regulator of G-protein signaling 8 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RGS8-regulator of G-protein signaling 8 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC069718
Product type:	DNA & cDNA
Ncbi symbol:	RGS8
Origin species:	Human
Product name:	RGS8-regulator of G-protein signaling 8 Gene
Size:	2ug
Accessions:	BC069718
Gene id:	85397
Gene description:	regulator of G-protein signaling 8
Synonyms:	regulator of G-protein signaling 8; regulator of G-protein signalling 8
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtggaacaccttaacccgaagcctctctgaccatccagttggcaaagaccctcaggccatgaggactggccaaagacagaacaaagggatgaggactcgactgggatgcctgtctcacaagtcagactcgtgtagtgatttcacagctattcttccagacaaacccaaccgcgctctcaagagattatcgacagaagaagctacgaggtgggcagattcctttgatgtgcttctctctcataagtatggggtggctgcattccgtgccttcttgaagacggagttcagtgaggagaacctggaattctggttggcctgtgaggagttcaagaagaccaggtccactgcaaaactggtctctaaggcccataggatctttgaggagtttgtggatgtgcaggctccacgggaggtaaacattgacttccagacccgagaagccacgaggaagaacctgcaggagccatccctgacttgctttgaccaagcccaaggaaaagtacacagcctcatggagaaagactcttaccccaggttcctgaggtccaaaatgtacttagatctgctgtcccaaagccagaggaggctcagttag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- taste receptor, type 2, member 8 - coiled-coil domain containing 80 - ornithine decarboxylase antizyme 3 - voltage-dependent anion channel 2

Reviews

Be the first to write your review !

Buy RGS8-regulator of G-protein signaling 8 Gene now