Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GREM1-gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) Gene
PTXBC069525
New product
Data sheet of GREM1-gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GREM1-gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069525 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GREM1 |
| Origin species: | Human |
| Product name: | GREM1-gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC069525 |
| Gene id: | 26585 |
| Gene description: | gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) |
| Synonyms: | C15DUPq; CKTSF1B1; CRAC1; CRCS4; DAND2; DRM; DUP15q; GREMLIN; HMPS; HMPS1; IHG-2; MPSH; PIG2; gremlin-1; DAN domain family member 2; cell proliferation-inducing gene 2 protein; colorectal adenoma and carcinoma 1; cysteine knot superfamily 1, BMP antagonist 1; down-regulated in Mos-transformed cells protein; gremlin 1, cysteine knot superfamily, homolog; gremlin 1-like protein; increased in high glucose-2; gremlin 1, DAN family BMP antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccgcacagcctacacggtgggagccctgcttctcctcttggggaccctgctgccggctgctgaagggaaaaagaaagggtcccaaggtgccatccccccgccagacaaggcccagcacaatgactcagagcagactcagtcgccccagcagcctggctccaggaaccgggggcggggccaagggcggggcactgccatgcccggggaggaggtgctggagtccagccaagaggccctgcatgtgacggagcgcaaatacctgaagcgagactggtgcaaaacccagccgcttaagcagaccatccacgaggaaggctgcaacagtcgcaccatcatcaaccgcttctgttacggccagtgcaactctttctacatccccaggcacatccggaaggaggaaggttcctttcagtcctgctccttctgcaagcccaagaaattcactaccatgatggtcacactcaactgccctgaactacagccacctaccaagaagaagagagtcacacgtgtgaagcagtgtcgttgcatatccatcgatttggattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis) - serpin peptidase inhibitor, clade B (ovalbumin), member 11 - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 |