Cart 8 Product Products 2 911,00 € (empty)
-
-
-
1 x ANKMY2-ank...121,50 € -
-
-
-
-
1 x TNF-alpha494,00 €
No products
To be determined Shipping
2 911,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 911,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 911,00 €
Data sheet of HBD-hemoglobin, delta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HBD-hemoglobin, delta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069307 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HBD |
| Origin species: | Human |
| Product name: | HBD-hemoglobin, delta Gene |
| Size: | 2ug |
| Accessions: | BC069307 |
| Gene id: | 3045 |
| Gene description: | hemoglobin, delta |
| Synonyms: | hemoglobin subunit delta; delta globin; delta-globin chain; hemoglobin delta chain; hemoglobin, delta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcatctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaacgtggatgcagttggtggtgaggccctgggcagattactggtggtctacccttggacccagaggttctttgagtcctttggggatctgtcctctcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaggtgctaggtgcctttagtgatggcctggctcacctggacaacctcaagggcactttttctcagctgagtgagctgcactgtgacaagctgcacgtggatcctgagaacttcaggctcttgggcaatgtgctggtgtgtgtgctggcccgcaactttggcaaggaattcaccccacaaatgcaggctgcctatcagaaggtggtggctggtgtggctaatgccctggctcacaagtaccattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peroxiredoxin 2 - interleukin 17A - EPH receptor B2 - angiopoietin 1 |