Cart 33 Product Products 4 599,64 € (empty)
-
1 x CLEC4E-C-t...113,40 € -
1 x RLBP1L2-re...121,50 € -
-
1 x IFRD2-inte...121,50 € -
1 x IFNA6-inte...113,40 € -
-
1 x CALM1-calm...113,40 € -
1 x OBFC2A-oli...113,40 € -
1 x Vaspin594,00 € -
1 x SUMF2-sulf...113,40 € -
1 x IFNA4-inte...113,40 € -
-
1 x IHPK2-inos...121,50 € -
1 x CCNJL-cycl...121,50 € -
1 x LEF1-lymph...121,50 € -
1 x HBEGF-hepa...113,40 € -
-
-
1 x HCCS-holoc...121,50 € -
1 x AP1S3-adap...113,40 € -
1 x SH3BGRL2-S...113,40 € -
1 x IDI1-isope...113,40 € -
-
1 x IFNA13-int...113,40 € -
-
1 x AP1S2-adap...113,40 € -
1 x ABHD14A-ab...121,50 € -
-
1 x AP2M1-adap...121,50 € -
1 x HGF-hepato...113,40 € -
1 x CCNC-cycli...121,50 € -
-
No products
To be determined Shipping
4 599,64 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 599,64 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 599,64 €
Data sheet of DLX6-distal-less homeobox 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DLX6-distal-less homeobox 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069363 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DLX6 |
| Origin species: | Human |
| Product name: | DLX6-distal-less homeobox 6 Gene |
| Size: | 2ug |
| Accessions: | BC069363 |
| Gene id: | 1750 |
| Gene description: | distal-less homeobox 6 |
| Synonyms: | homeobox protein DLX-6; distal-less homeo box 6; distal-less homeobox 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccactcgcagcacagcccttacctccagtcctaccacaacagcagcgcagccgcccagacgcgaggggacgacacagatcaacaaaaaactacagtgattgaaaacggggaaatcaggttcaatggaaaagggaaaaagattcggaagcctcggaccatttattccagcctgcagctccaggctttaaaccatcgctttcagcagacacagtatctggcccttccagagagagccgaactggcagcttccttaggactgacacaaacacaggtgaagatatggtttcagaacaaacgctctaagtttaagaaactgctgaagcagggcagtaatcctcatgagagcgaccccctccagggctcggcggccctgtcgccacgctcgccagcgctgcctccagtctgggacgtttctgcctcggccaagggtgtcagtatgccccccaacagctacatgcctggctattctcactggtactcctctccacaccaggacacgatgcagagaccacagatgatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich 5 (renal) - ribosomal protein L15 - ribosomal protein S16 - myo-inositol oxygenase |