VGLL2-vestigial like 2 (Drosophila) Gene

View larger

VGLL2-vestigial like 2 (Drosophila) Gene

Reference: PTXBC069316

Condition: New product

Print

Data sheet of VGLL2-vestigial like 2 (Drosophila) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about VGLL2-vestigial like 2 (Drosophila) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC069316
Product type:	DNA & cDNA
Ncbi symbol:	VGLL2
Origin species:	Human
Product name:	VGLL2-vestigial like 2 (Drosophila) Gene
Size:	2ug
Accessions:	BC069316
Gene id:	245806
Gene description:	vestigial like 2 (Drosophila)
Synonyms:	VGL2; VITO1; transcription cofactor vestigial-like protein 2; Vestigial and Tondu related protein 1; vestigial like 2; vestigial like family member 2
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgagctgtctggatgttatgtaccaagtctatggtcctccgcagccctacttcgcagccgcctacaccccctaccaccagaaactagcctattattccaaaatgcaggaagcgcaggagtgcaatgccagccccagcagcagtggcagcggcagctcctcattttccagccaaaccccagccagtataaaagaggaagaaggcagcccagagaaagagcgcccaccagaggcagagtacatcaactcccgctgcgtcctcttcacttatttccagggggacatcagctccgtggtggatgaacatttcagcagggccctgagccaacccagcagctactctcctagctgtaccagcagcaaagcaccaaggagctctgggccctggcgagctcgtcgttattccctctgtggtgcatccctcctgagctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- chemokine (C motif) receptor 1 - G protein-coupled receptor 15 - G protein-coupled receptor 52 - activin A receptor, type IIA

Reviews

Be the first to write your review !

Buy VGLL2-vestigial like 2 (Drosophila) Gene now