Cart 49 Product Products 7 307,88 € (empty)
-
1 x CTHRC1-col...113,40 € -
1 x MPV17-MpV1...113,40 € -
1 x HMGB1-high...113,40 € -
1 x MTFR1-mito...121,50 € -
1 x ARMET-argi...113,40 € -
-
-
1 x SH3BP5-SH3...121,50 € -
1 x TFF1-trefo...113,40 € -
1 x XPA-xerode...121,50 € -
1 x ETV1-ets...121,50 € -
-
1 x C11orf51-c...113,40 € -
1 x C1orf156-c...121,50 € -
1 x PACSIN2-pr...121,50 € -
1 x ASPH-aspar...113,40 € -
1 x WDR92-WD...121,50 € -
1 x TOMM40-tra...121,50 € -
1 x GAS7-growt...121,50 € -
1 x CBX6-chrom...121,50 € -
1 x ATG12-ATG1...113,40 € -
1 x TRAPPC10-t...121,50 € -
1 x G6PC2-gluc...121,50 € -
-
1 x AFAP1L1-ac...121,50 € -
1 x GATA2-GATA...121,50 € -
-
-
1 x POLD2-poly...121,50 € -
1 x WSCD2-WSC...113,40 € -
1 x SIX2-SIX...121,50 € -
1 x CACNG1-cal...113,40 € -
1 x APOL1-apol...113,40 € -
1 x CBARA1-cal...121,50 € -
1 x IGLC1-immu...113,40 € -
1 x LigaTrap...984,64 € -
1 x SEMG1-seme...121,50 € -
1 x TRPT1-tRNA...113,40 € -
1 x ANKRD54-an...121,50 € -
-
1 x Collagen...744,00 € -
1 x IL1RN-inte...113,40 € -
1 x PLTP-phosp...121,50 € -
1 x SPSB2-splA...113,40 € -
1 x XKR3-XK,...121,50 € -
1 x VCAN-versi...121,50 € -
-
1 x TTRAP-TRAF...121,50 € -
1 x RPS16-ribo...113,40 €
No products
To be determined Shipping
7 307,88 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 49 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 307,88 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 307,88 €
View larger 
Data sheet of PAEP-progestagen-associated endometrial protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAEP-progestagen-associated endometrial protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069451 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAEP |
| Origin species: | Human |
| Product name: | PAEP-progestagen-associated endometrial protein Gene |
| Size: | 2ug |
| Accessions: | BC069451 |
| Gene id: | 5047 |
| Gene description: | progestagen-associated endometrial protein |
| Synonyms: | GdA; GdF; GdS; PAEG; PEP; PP14; glycodelin; PEG; PP14 protein (placental protein 14); alpha uterine protein; glycodelin-A; glycodelin-F; glycodelin-S; placental protein 14; pregnancy-associated endometrial alpha-2 globulin; progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial a; progesterone-associated endometrial protein; progestagen associated endometrial protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtgcctcctgctcaccctgggcgtggccctggtctgtggtgtcccggccatggacatcccccagaccaagcaggacctggagctcccaaagttggcagggacctggcactccatggccatggcgaccaacaacatctccctcatggcgacactgaaggcccctctgagggtccacatcacctcactgttgcccacccccgaggacaacctggagatcgttctgcacagatgggagaacaacagctgtgttgagaagaaggtccttggagagaagactgagaatccaaagaagttcaagatcaactatacggtggcgaacgaggccacgctgctcgatactgactacgacaatttcctgtttctctgcctacaggacaccaccacccccatccagagcatgatgtgccagtacctggccagagtcctggtggaggacgatgagatcatgcagggattcatcagggctttcaggcccctgcccaggcacctatggtacttgctggacttgaaacagatggaagagccgtgccgtttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - p21 protein (Cdc42/Rac)-activated kinase 2 - A kinase (PRKA) anchor protein (yotiao) 9 - LIM homeobox transcription factor 1, beta - zinc finger and SCAN domain containing 1 |