Cart 25 Product Products 17 067,49 € (empty)
-
-
1 x MRPL14-mit...113,40 € -
1 x PFDN5-pref...113,40 € -
1 x HSD11B1L-h...113,40 € -
1 x BCAS1-brea...121,50 € -
1 x PARP6-poly...113,40 € -
-
-
1 x C17orf62-c...113,40 € -
1 x C3AR1-comp...121,50 € -
1 x RTN4-retic...121,50 € -
-
-
-
1 x CEP170L-ce...121,50 € -
1 x KLHL20-kel...113,40 € -
1 x PPAN-peter...121,50 € -
1 x SRPX2-sush...121,50 € -
1 x E2F3-E2F...113,40 € -
1 x HLA-A-majo...121,50 € -
1 x MMD-monocy...113,40 € -
1 x C10orf116-...113,40 € -
1 x CPLX2-comp...113,40 € -
1 x FAM134B-fa...113,40 € -
1 x StARD13...259,07 €
No products
To be determined Shipping
17 067,49 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 17 067,49 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 17 067,49 €
Data sheet of CRYGS-crystallin, gamma S Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRYGS-crystallin, gamma S Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069478 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRYGS |
| Origin species: | Human |
| Product name: | CRYGS-crystallin, gamma S Gene |
| Size: | 2ug |
| Accessions: | BC069478 |
| Gene id: | 1427 |
| Gene description: | crystallin, gamma S |
| Synonyms: | CRYG8; CTRCT20; beta-crystallin S; crystallin, gamma 8; crystallin gamma S |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaaaactggaaccaagattactttctatgaagacaaaaattttcaaggccgtcgctatgactgtgattgcgactgtgcagatttccacacatacctaagtcgctgcaactccattaaagtggaaggaggcacctgggctgtttatgaaaggcccaactttgctgggtacatgtacatcttaccacagggagagtaccctgaataccagcgttggatgggcctcaacgaccgcctcagctcctgcagagctgttcatctgcctagtggaggccagtataagattcagatctttgagaaaggggattttagtggtcagatgtatgaaaccaccgaagattgcccttccatcatggagcaatttcacatgcgagagatccactcctgtaaggtgctggagggtgtctggattttctatgagctacccaactaccgtggcaggcagtacctcctggacaagaaggagtaccggaagcccatcgattggggtgcagcctccccagctgtccagtctttccgccgcattgtggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - elastase 2B - crystallin, alpha A - elastase 2B - chymase 1, mast cell |