Cart 2 Product Products 234,90 € (empty)
-
1 x SMPX-small...113,40 € -
1 x ZBTB24-zin...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of MDS1-myelodysplasia syndrome 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MDS1-myelodysplasia syndrome 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069498 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MDS1 |
| Origin species: | Human |
| Product name: | MDS1-myelodysplasia syndrome 1 Gene |
| Size: | 2ug |
| Accessions: | BC069498 |
| Gene id: | 4197 |
| Gene description: | myelodysplasia syndrome 1 |
| Synonyms: | MDS1 and EVI1 complex locus; MDS1 and EVI1 complex locus protein MDS1; MDS1 and EVI1 complex locus protein EVI1; MDS1-EVI1; MDS1; AML1-EVI-1; EVI1; KMT8E; PRDM3; RUSAT2; AML1-EVI-1 fusion protein; PR domain 3; ecotropic virus integration site 1 protein homolog; myelodysplasia syndrome-associated protein 1; oncogene EVI1; zinc finger protein Evi1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagatccaaaggcagggcaaggaaactggccacaaataatgagtgtgtatatggcaactaccctgaaatacctttggaagaaatgccagatgcagatggagtagccagcactccctccctcaatattcaagagccatgctctcctgccacatccagtgaagcattcactccaaaggagggttctccttacaaagcccccatctacatccctgatgatatccccattcctgctgagtttgaacttcgagagtcaaatatgcctggggcaggactaggaatatggaccaaaaggaagatcgaagtaggtgaaaagtttgggccttatgtgggagagcagaggtcaaacctgaaagaccccagttatggatgggaggtacatcttccaaggtctcggagggtaagcgttcactcttggttgtatttggggaagagaagctcagacgtaggaatagccttctctcaggctgatgtctacatgcctggactgcagtgtgccttcctctcgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - urocortin 3 (stresscopin) - ring finger protein 170 - zinc finger protein 200 - cyclin-dependent kinase 8 |