Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LAIR2-leukocyte-associated immunoglobulin-like receptor 2 Gene
PTXBC069366
New product
Data sheet of LAIR2-leukocyte-associated immunoglobulin-like receptor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAIR2-leukocyte-associated immunoglobulin-like receptor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069366 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAIR2 |
| Origin species: | Human |
| Product name: | LAIR2-leukocyte-associated immunoglobulin-like receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC069366 |
| Gene id: | 3904 |
| Gene description: | leukocyte-associated immunoglobulin-like receptor 2 |
| Synonyms: | CD306; leukocyte-associated immunoglobulin-like receptor 2; LAIR-2; leukocyte-associated Ig-like receptor-2; leukocyte associated immunoglobulin like receptor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctccacacctcactgctctcctgggcctagtgctctgcctggcccagaccatccacacgcaggagggggcccttcccagaccctccatctcggctgagccaggcactgtgatctccccggggagccatgtgactttcatgtgccggggcccggttggggttcaaacattccgcctggagagggaggatagagccaagtacaaagatagttataatgtgtttcgacttggtccatctgagtcagaggccagattccacattgactcagtaagtgaaggaaatgccgggctttatcgctgcctctattataagccccctggatggtctgagcacagtgacttcctggagctgctggtgaaagaaagctctggaggcccggactccccggacacagagcccggctcctcagctgggactgtgccaggcactgaagcctccggatttgatgcaccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 2, subfamily C, member 1 - ring finger and CHY zinc finger domain containing 1 - vacuolar protein sorting 29 homolog (S. cerevisiae) - ATP-binding cassette, sub-family A (ABC1), member 8 |