Cart 22 Product Products 3 323,92 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 € -
1 x CXCL13-che...113,40 € -
1 x COL20A1-co...113,40 € -
1 x LRRC14-leu...121,50 €
No products
To be determined Shipping
3 323,92 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 323,92 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 323,92 €
Data sheet of KRTAP5-9-keratin associated protein 5-9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP5-9-keratin associated protein 5-9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069531 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP5-9 |
| Origin species: | Human |
| Product name: | KRTAP5-9-keratin associated protein 5-9 Gene |
| Size: | 2ug |
| Accessions: | BC069531 |
| Gene id: | 3846 |
| Gene description: | keratin associated protein 5-9 |
| Synonyms: | KRN1; KRTAP5-1; KRTAP5.9; keratin-associated protein 5-9; UHS KerA; UHS keratin A; keratin, cuticle, ultrahigh sulfur 1; keratin, cuticle, ultrahigh sulphur 1; keratin, ultra high-sulfur matrix protein A; keratin-associated protein 5.9; ultrahigh sulfur keratin-associated protein 5.9; keratin associated protein 5-9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctgctgtggctgctccggaggctgtggctccagctgtggaggctgtgactccagctgtgggagctgtggctctggctgcaggggctgtggccccagctgctgtgcacccgtctactgctgcaagcccgtgtgctgctgtgttccagcctgttcctgctctagctgtggcaagcggggctgtggctcctgtgggggctccaagggaggctgtggttcttgtggctgctcccagtgcagttgctgcaagccctgctgttgctcttcaggctgtgggtcatcctgctgccagtgcagctgctgcaagccctactgctcccagtgcagctgctgtaagccctgttgctcctcctcgggtcgtgggtcatcctgctgccaatccagctgctgcaagccctgctgctcatcctcaggctgtgggtcatcctgctgccagtccagctgctgcaagccctgctgctcccagtccagatgctgtgtccctgtgtgctaccagtgcaagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphocyte transmembrane adaptor 1 - taste receptor, type 2, member 5 - regulator of G-protein signaling 8 - coiled-coil domain containing 70 |