Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SCGB1C1-secretoglobin, family 1C, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCGB1C1-secretoglobin, family 1C, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069287 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCGB1C1 |
| Origin species: | Human |
| Product name: | SCGB1C1-secretoglobin, family 1C, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC069287 |
| Gene id: | 147199 |
| Gene description: | secretoglobin, family 1C, member 1 |
| Synonyms: | RYD5; secretoglobin family 1C member 1; ligand binding protein RYD5; secretoglobin RYD5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggggagccgtgccctcctgctggtggccctcaccctgttctgcatctgccggatggccacaggggaggacaacgatgagtttttcatggacttcctgcaaacactactggtggggaccccagaggagctctatgaggggaccttgggcaagtacaatgtcaacgaagatgccaaggcagcaatgactgaactcaagtcctgcagagatggcctgcagccaatgcacaaggcggagctggtcaagctgctggtgcaagtgctgggcagtcaggacggtgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Down syndrome critical region gene 4 - calcitonin-related polypeptide alpha - chromosome 5 open reading frame 20 - solute carrier family 38, member 4 |