Cart 13 Product Products 2 908,06 € (empty)
-
1 x CCNG1-cycl...121,50 € -
1 x KTI12-KTI1...121,50 € -
-
-
1 x TM-CYFRA 21-1399,00 € -
-
-
-
1 x TSH...449,00 € -
1 x HP-haptogl...113,40 € -
1 x EXOSC7-exo...121,50 € -
1 x Histone H3...259,07 € -
No products
To be determined Shipping
2 908,06 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 908,06 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 908,06 €
Data sheet of GAST-gastrin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAST-gastrin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069724 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAST |
| Origin species: | Human |
| Product name: | GAST-gastrin Gene |
| Size: | 2ug |
| Accessions: | BC069724 |
| Gene id: | 2520 |
| Gene description: | gastrin |
| Synonyms: | GAS; preprogastrin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagcgactatgtgtgtatgtgctgatctttgcactggctctggccgccttctctgaagcttcttggaagccccgctcccagcagccagatgcacccttaggtacaggggccaacagggacctggagctaccctggctggagcagcagggcccagcctctcatcatcgaaggcagctgggaccccagggtcccccacacctcgtggcagacccgtccaagaagcagggaccatggctggaggaagaagaagaagcctatggatggatggacttcggccgccgcagtgctgaggatgagaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dystonin - vasorin - triadin - T-box 3 |