LACRT-lacritin Gene View larger

LACRT-lacritin Gene

PTXBC069317

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LACRT-lacritin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LACRT-lacritin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069317
Product type: DNA & cDNA
Ncbi symbol: LACRT
Origin species: Human
Product name: LACRT-lacritin Gene
Size: 2ug
Accessions: BC069317
Gene id: 90070
Gene description: lacritin
Synonyms: extracellular glycoprotein lacritin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaacagcccaggagacttcggcggcagcagttcaggggacagccaaagtcacctcaagcaggcaggaactaaaccccctgaaatccatagtggagaaaagtatcttactaacagaacaagcccttgcaaaagcaggaaaaggaatgcacggaggcgtgccaggtggaaaacaattcatcgaaaatggaagtgaatttgcacaaaaattactgaagaaattcagtctattaaaaccatgggcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fetuin B
- dermokine
- involucrin
- metaxin 2

Reviews

Buy LACRT-lacritin Gene now

Add to cart