Cart 9 Product Products 1 369,84 € (empty)
-
-
1 x CCNI-cycli...121,50 € -
-
1 x SETDB1-SET...121,50 € -
1 x IFNAR2-int...121,50 € -
1 x SETMAR-SET...121,50 € -
-
1 x RTCD1-RNA...121,50 € -
No products
To be determined Shipping
1 369,84 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 369,84 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 369,84 €
Data sheet of RETN-resistin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RETN-resistin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069302 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RETN |
| Origin species: | Human |
| Product name: | RETN-resistin Gene |
| Size: | 2ug |
| Accessions: | BC069302 |
| Gene id: | 56729 |
| Gene description: | resistin |
| Synonyms: | ADSF; FIZZ3; RETN1; RSTN; XCP1; C/EBP-epsilon regulated myeloid-specific secreted cysteine-rich protein precursor 1; adipose tissue-specific secretory factor; c/EBP-epsilon-regulated myeloid-specific secreted cysteine-rich protein; cysteine-rich secreted protein A12-alpha-like 2; cysteine-rich secreted protein FIZZ3; found in inflammatory zone 3; resistin delta2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagctctctgtctcctcctcctccctgtcctggggctgttggtgtctagcaagaccctgtgctccatggaagaagccatcaatgagaggatccaggaggtcgccggctccctaatatttagggcaataagcagcattggcctggagtgccagagcgtcacctccaggggggacctggctacttgcccccgaggcttcgccgtcaccggctgcacttgtggctccgcctgtggctcgtgggatgtgcgcgccgagaccacatgtcactgccagtgcgcgggcatggactggaccggagcgcgctgctgtcgtgtgcagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - versican - cereblon - tensin 1 - tensin 3 |