Cart 9 Product Products 1 033,37 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 € -
-
No products
To be determined Shipping
1 033,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 033,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 033,37 €
Data sheet of KRTAP3-3-keratin associated protein 3-3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP3-3-keratin associated protein 3-3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069448 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP3-3 |
| Origin species: | Human |
| Product name: | KRTAP3-3-keratin associated protein 3-3 Gene |
| Size: | 2ug |
| Accessions: | BC069448 |
| Gene id: | 85293 |
| Gene description: | keratin associated protein 3-3 |
| Synonyms: | KAP3.3; KRTAP3.3; keratin-associated protein 3-3; high sulfur keratin-associated protein 3.3; keratin-associated protein 3.3; keratin associated protein 3-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattgctgtgcctctcgaggctgcagtgtccccaccgggcctgccaccaccatctgctcctccgacaaatcctgtcgctgtggagtctgcctgcccagcacctgcccacacacagtttggttactggagcccacctgctgtgacaactgtcccccaccctgccacattcctcagccctgtgtgcccacctgcttcctgctcaactcctgccagccaactccaggcctggagaccctcaacctcaccaccttcactcagccctgctgtgagccctgcctcccaagaggctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - oxysterol binding protein-like 7 - keratin associated protein 5-9 - lymphocyte transmembrane adaptor 1 - taste receptor, type 2, member 5 |