PTXBC069393
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC069393 |
Product type: | DNA & cDNA |
Ncbi symbol: | SPANXA1 |
Origin species: | Human |
Product name: | SPANXA1-sperm protein associated with the nucleus, X-linked, family member A1 Gene |
Size: | 2ug |
Accessions: | BC069393 |
Gene id: | 30014 |
Gene description: | sperm protein associated with the nucleus, X-linked, family member A1 |
Synonyms: | CT11.1; NAP-X; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX; SPANX-A; sperm protein associated with the nucleus on the X chromosome A; SPANX family member A; SPANX family, member A1; cancer/testis antigen 11.1; cancer/testis antigen family 11, member 1; nuclear-associated protein SPAN-Xa; sperm protein associated with the nucleus, X chromosome, family member A1; sperm protein associated with the nucleus, X-linked, family member A1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaactttaaaagaacatctccagaggaactgttgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - solute carrier family 37 (glycerol-3-phosphate transporter), member 3 - solute carrier family 4 (anion exchanger), member 1, adaptor protein - translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) |