Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene
PTXBC042147
New product
Data sheet of KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042147 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNN3 |
| Origin species: | Human |
| Product name: | KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC042147 |
| Gene id: | 3782 |
| Gene description: | potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 |
| Synonyms: | KCa2.3; SK3; SKCA3; hSK3; small conductance calcium-activated potassium channel protein 3; SKCa 3; potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 3; potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3; small conductance calcium-activated potassium channel 3; potassium calcium-activated channel subfamily N member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcctgtacatcagcctggagatgctggtgtgcgccatccaccccattcctggcgagtacaagttcttctggacggcacgcctggccttctcctacacaccctcccgggcggaggccgatgtggacatcatcctgtctatccccatgttcctgcgcctgtacctgatcgcccgagtcatgctgctgcacagcaagctcttcaccgatgcctcgtcccgcagcatcggggccctcaacaagatcaacttcaacacccgctttgtcatgaagacgctcatgaccatctgccctggcactgtgctgctcgtgttcagcatctctctgtggatcattgctgcctggaccgtccgtgtctgtgaaaggtaccatgaccagcaggacgtaactagtaactttctgggtgccatgtggctcatctccatcacattcctttccattggttatggggacatggtgccccacacatactgtgggaaaggtgtctgtctcctcactggcatcatgggtgcaggctgcactgcccttgtggtggccgtggtggcccgaaagctggaactcaccaaagcggagaagcacgttcataacttcatgatggacactcagctcaccaagcggatcaagaatgctgcagccaatgtccttcgggaaacatggttaatctataaacacacaaagctgctaaagaagattgaccatgccaaagtgaggaaacaccagaggaagttcctccaagctatccaccagttgaggagcgtcaagatggaacagaggaagctgagtgaccaagccaacactctggtggacctttccaagatgcagaatgtcatgtatgacttaatcacagaactcaatgaccggagcgaagacctggagaagcagattggcagcctggagtcgaagctggagcatctcaccgccagcttcaactccctgccgctgctcatcgccgacaccctgcgccagcagcagcagcagctcctgtctgccatcatcgaggcccggggtgtcagcgtggcagtgggcaccacccacaccccaatctccgatagccccattggggtcagctccacctccttcccgaccccgtacacaagttcaagcagttgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 - heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) - proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) - ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle |