Cart 17 Product Products 2 459,01 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 €
No products
To be determined Shipping
2 459,01 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 459,01 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 459,01 €
Data sheet of SHQ1-SHQ1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SHQ1-SHQ1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC017204 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SHQ1 |
| Origin species: | Human |
| Product name: | SHQ1-SHQ1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC017204 |
| Gene id: | 55164 |
| Gene description: | SHQ1 homolog (S. cerevisiae) |
| Synonyms: | SHQ1, H/ACA ribonucleoprotein assembly factor; SHQ1 homolog; protein SHQ1 homolog; GRIM-1; Shq1p; gene associated with retinoid and interferon-induced mortality 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaccccggcgttcgacctcagccaggatccggacttcctgactatcgccatccgcgtgccctacgcccgggtctccgagttcgacgtctacttcgaggggtctgacttcaagttctacgccaagccatactttctcagattaacccttcctggaagaattgtagaaaatggaagtgagcaagggtcctatgatgcagataaaggaatttttaccattcgcctgcccaaagaaacccctggccagcattttgaggggctgaacatgttaactgctcttctggcaccaagaaaatccaggacagcaaaaccacttgtggaagaaataggtgcttctgagattcctgaggaagtagttgacgatgaagagtttgattgggaaattgagcagacaccctgtgaagaggtatcagaaagtgctttgaatccgcagtgccactatggatttggaaacttacgatcaggagtgttgcaacggttacaggatgaactgagtgatgttattgatattaaggatccagatttcacccctgcagctgaacgaagacagaagcgcctggccgctgagctggccaagtttgatcctgatcattatctagctgacttttttgaagatgaggcgattgaacagattttgaagtataatccttggtggactgacaaatattcaaaaatgatggcctttttggaaaagagtcaggaacaagaaaatcatgctacattagtgtctttttctgaagaagagaagtatcagctacgaaaatttgtcaataaatcttatctgctggacaagagagcctgtcgtcaagtgtgctacagtttgattgatatccttctggcatattgctatgaaacccgtgtcactgaaggagagaagaatgttgaatctgcatggaatatcaggaaactgagtccaacactatgctggtttgagacttggactaacgttcatgatatcatggtgtcttttggaagaagggtgttgtgttacccactctatcgccatttcaagctggtgatgaaggcctacagggacactataaagatattgcaactgggtaaaagtgcagttttaaagtgtctcctggatattcacaaaatttttcaggaaaatgacccagcgtacatactgaatgatctctacatctcagactactgtgtgtggattcagaaagtcaaatccaaaaagttggcagctcttgcagaagccttaaaggaagtctcccttacaaaggcccagctggggttagaactggaagaactagaagcagcagcactgcttgtccaggaggaagaaactgcattaaaagcagcccattcagtttctgggcagcagacactttgctccagctctgaggcaagtgattcggaggactcagacagcagcgtgtcatctggaaacgaagactcaggctcagattcagaacaagatgaactcaaagatagtccatctgagacagtcagttctttgcaaggtccctttcttgaagaaagcagtgcctttcttattgttgatggtggagtacgcagaaacacagccatccaggagtctgatgccagtcagggaaagccacttgcctcttcctggcctcttggagtgtctgggcctctgatagaggagcttggggaacaactgaagactacagttcaggtttctgaacccaagggcaccactgctgtaaaccgcagcaatattcaggagagagacggctgtcagacaccaaataattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - collagen, type VI, alpha 1 - histone cluster 1, H2al - chemokine (C motif) ligand 2 - fibroblast growth factor 23 |